ID: 1141664875 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:85460869-85460891 |
Sequence | GTGAGAGTGGGCTGCAAATC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141664868_1141664875 | 3 | Left | 1141664868 | 16:85460843-85460865 | CCAGAGCAGTTCAGACCCAGGGG | No data | ||
Right | 1141664875 | 16:85460869-85460891 | GTGAGAGTGGGCTGCAAATCAGG | No data | ||||
1141664865_1141664875 | 28 | Left | 1141664865 | 16:85460818-85460840 | CCAGGGTGGGGGTGGGGAGAGTC | No data | ||
Right | 1141664875 | 16:85460869-85460891 | GTGAGAGTGGGCTGCAAATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141664875 | Original CRISPR | GTGAGAGTGGGCTGCAAATC AGG | Intergenic | ||