ID: 1141664877

View in Genome Browser
Species Human (GRCh38)
Location 16:85460893-85460915
Sequence CGTGAAGTCTGATGACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664872_1141664877 12 Left 1141664872 16:85460858-85460880 CCCAGGGGACCGTGAGAGTGGGC No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data
1141664874_1141664877 3 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data
1141664873_1141664877 11 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data
1141664868_1141664877 27 Left 1141664868 16:85460843-85460865 CCAGAGCAGTTCAGACCCAGGGG No data
Right 1141664877 16:85460893-85460915 CGTGAAGTCTGATGACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664877 Original CRISPR CGTGAAGTCTGATGACAGAT GGG Intergenic
No off target data available for this crispr