ID: 1141664878

View in Genome Browser
Species Human (GRCh38)
Location 16:85460898-85460920
Sequence AGTCTGATGACAGATGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141664873_1141664878 16 Left 1141664873 16:85460859-85460881 CCAGGGGACCGTGAGAGTGGGCT No data
Right 1141664878 16:85460898-85460920 AGTCTGATGACAGATGGGAAAGG No data
1141664874_1141664878 8 Left 1141664874 16:85460867-85460889 CCGTGAGAGTGGGCTGCAAATCA No data
Right 1141664878 16:85460898-85460920 AGTCTGATGACAGATGGGAAAGG No data
1141664872_1141664878 17 Left 1141664872 16:85460858-85460880 CCCAGGGGACCGTGAGAGTGGGC No data
Right 1141664878 16:85460898-85460920 AGTCTGATGACAGATGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141664878 Original CRISPR AGTCTGATGACAGATGGGAA AGG Intergenic
No off target data available for this crispr