ID: 1141664879 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:85460899-85460921 |
Sequence | GTCTGATGACAGATGGGAAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141664874_1141664879 | 9 | Left | 1141664874 | 16:85460867-85460889 | CCGTGAGAGTGGGCTGCAAATCA | No data | ||
Right | 1141664879 | 16:85460899-85460921 | GTCTGATGACAGATGGGAAAGGG | No data | ||||
1141664872_1141664879 | 18 | Left | 1141664872 | 16:85460858-85460880 | CCCAGGGGACCGTGAGAGTGGGC | No data | ||
Right | 1141664879 | 16:85460899-85460921 | GTCTGATGACAGATGGGAAAGGG | No data | ||||
1141664873_1141664879 | 17 | Left | 1141664873 | 16:85460859-85460881 | CCAGGGGACCGTGAGAGTGGGCT | No data | ||
Right | 1141664879 | 16:85460899-85460921 | GTCTGATGACAGATGGGAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141664879 | Original CRISPR | GTCTGATGACAGATGGGAAA GGG | Intergenic | ||