ID: 1141665211

View in Genome Browser
Species Human (GRCh38)
Location 16:85462348-85462370
Sequence CTGAGGGTAGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665211_1141665222 10 Left 1141665211 16:85462348-85462370 CCCTCCACCCTCCCTACCCTCAG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665211 Original CRISPR CTGAGGGTAGGGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr