ID: 1141665222

View in Genome Browser
Species Human (GRCh38)
Location 16:85462381-85462403
Sequence GGTTGCCTGCCCTCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665220_1141665222 -6 Left 1141665220 16:85462364-85462386 CCCTCAGCTTGTTGGTTGGTTGC No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665217_1141665222 -1 Left 1141665217 16:85462359-85462381 CCCTACCCTCAGCTTGTTGGTTG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665212_1141665222 9 Left 1141665212 16:85462349-85462371 CCTCCACCCTCCCTACCCTCAGC No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665213_1141665222 6 Left 1141665213 16:85462352-85462374 CCACCCTCCCTACCCTCAGCTTG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665214_1141665222 3 Left 1141665214 16:85462355-85462377 CCCTCCCTACCCTCAGCTTGTTG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665221_1141665222 -7 Left 1141665221 16:85462365-85462387 CCTCAGCTTGTTGGTTGGTTGCC No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665215_1141665222 2 Left 1141665215 16:85462356-85462378 CCTCCCTACCCTCAGCTTGTTGG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665211_1141665222 10 Left 1141665211 16:85462348-85462370 CCCTCCACCCTCCCTACCCTCAG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data
1141665218_1141665222 -2 Left 1141665218 16:85462360-85462382 CCTACCCTCAGCTTGTTGGTTGG No data
Right 1141665222 16:85462381-85462403 GGTTGCCTGCCCTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665222 Original CRISPR GGTTGCCTGCCCTCCTCTCC TGG Intergenic
No off target data available for this crispr