ID: 1141665395

View in Genome Browser
Species Human (GRCh38)
Location 16:85462964-85462986
Sequence GGCAGAAGACGGGCCCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665395_1141665410 23 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665410 16:85463010-85463032 GCCTCCGCCGCGGGCCATGCTGG No data
1141665395_1141665412 24 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665395_1141665408 13 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665395_1141665409 14 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665409 16:85463001-85463023 CTACTGCTCGCCTCCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665395 Original CRISPR GGCAGAAGACGGGCCCGGAG GGG (reversed) Intergenic
No off target data available for this crispr