ID: 1141665408

View in Genome Browser
Species Human (GRCh38)
Location 16:85463000-85463022
Sequence CCTACTGCTCGCCTCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665397_1141665408 11 Left 1141665397 16:85462966-85462988 CCTCCGGGCCCGTCTTCTGCCGC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665388_1141665408 26 Left 1141665388 16:85462951-85462973 CCGTCTCCCCCGCCCCCTCCGGG No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665396_1141665408 12 Left 1141665396 16:85462965-85462987 CCCTCCGGGCCCGTCTTCTGCCG No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665391_1141665408 19 Left 1141665391 16:85462958-85462980 CCCCGCCCCCTCCGGGCCCGTCT No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665386_1141665408 27 Left 1141665386 16:85462950-85462972 CCCGTCTCCCCCGCCCCCTCCGG No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665398_1141665408 8 Left 1141665398 16:85462969-85462991 CCGGGCCCGTCTTCTGCCGCCCC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665390_1141665408 20 Left 1141665390 16:85462957-85462979 CCCCCGCCCCCTCCGGGCCCGTC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665395_1141665408 13 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665385_1141665408 28 Left 1141665385 16:85462949-85462971 CCCCGTCTCCCCCGCCCCCTCCG No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665394_1141665408 14 Left 1141665394 16:85462963-85462985 CCCCCTCCGGGCCCGTCTTCTGC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665399_1141665408 3 Left 1141665399 16:85462974-85462996 CCCGTCTTCTGCCGCCCCGTGAC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665392_1141665408 18 Left 1141665392 16:85462959-85462981 CCCGCCCCCTCCGGGCCCGTCTT No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665400_1141665408 2 Left 1141665400 16:85462975-85462997 CCGTCTTCTGCCGCCCCGTGACG No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665401_1141665408 -8 Left 1141665401 16:85462985-85463007 CCGCCCCGTGACGCCCCTACTGC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data
1141665393_1141665408 17 Left 1141665393 16:85462960-85462982 CCGCCCCCTCCGGGCCCGTCTTC No data
Right 1141665408 16:85463000-85463022 CCTACTGCTCGCCTCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665408 Original CRISPR CCTACTGCTCGCCTCCGCCG CGG Intergenic
No off target data available for this crispr