ID: 1141665412

View in Genome Browser
Species Human (GRCh38)
Location 16:85463011-85463033
Sequence CCTCCGCCGCGGGCCATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665405_1141665412 -10 Left 1141665405 16:85462998-85463020 CCCCTACTGCTCGCCTCCGCCGC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665401_1141665412 3 Left 1141665401 16:85462985-85463007 CCGCCCCGTGACGCCCCTACTGC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665397_1141665412 22 Left 1141665397 16:85462966-85462988 CCTCCGGGCCCGTCTTCTGCCGC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665398_1141665412 19 Left 1141665398 16:85462969-85462991 CCGGGCCCGTCTTCTGCCGCCCC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665396_1141665412 23 Left 1141665396 16:85462965-85462987 CCCTCCGGGCCCGTCTTCTGCCG No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665399_1141665412 14 Left 1141665399 16:85462974-85462996 CCCGTCTTCTGCCGCCCCGTGAC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665393_1141665412 28 Left 1141665393 16:85462960-85462982 CCGCCCCCTCCGGGCCCGTCTTC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665392_1141665412 29 Left 1141665392 16:85462959-85462981 CCCGCCCCCTCCGGGCCCGTCTT No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665400_1141665412 13 Left 1141665400 16:85462975-85462997 CCGTCTTCTGCCGCCCCGTGACG No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665403_1141665412 -1 Left 1141665403 16:85462989-85463011 CCCGTGACGCCCCTACTGCTCGC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665394_1141665412 25 Left 1141665394 16:85462963-85462985 CCCCCTCCGGGCCCGTCTTCTGC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665395_1141665412 24 Left 1141665395 16:85462964-85462986 CCCCTCCGGGCCCGTCTTCTGCC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665402_1141665412 0 Left 1141665402 16:85462988-85463010 CCCCGTGACGCCCCTACTGCTCG No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665404_1141665412 -2 Left 1141665404 16:85462990-85463012 CCGTGACGCCCCTACTGCTCGCC No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data
1141665391_1141665412 30 Left 1141665391 16:85462958-85462980 CCCCGCCCCCTCCGGGCCCGTCT No data
Right 1141665412 16:85463011-85463033 CCTCCGCCGCGGGCCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665412 Original CRISPR CCTCCGCCGCGGGCCATGCT GGG Intergenic
No off target data available for this crispr