ID: 1141665996

View in Genome Browser
Species Human (GRCh38)
Location 16:85465399-85465421
Sequence TTCATTACTGCTGTGTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141665990_1141665996 6 Left 1141665990 16:85465370-85465392 CCAGGCCTGGGCTCCCATCTGGG No data
Right 1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG No data
1141665992_1141665996 1 Left 1141665992 16:85465375-85465397 CCTGGGCTCCCATCTGGGTTCTC No data
Right 1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG No data
1141665993_1141665996 -7 Left 1141665993 16:85465383-85465405 CCCATCTGGGTTCTCCTTCATTA No data
Right 1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG No data
1141665987_1141665996 18 Left 1141665987 16:85465358-85465380 CCATGAACAGCGCCAGGCCTGGG No data
Right 1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG No data
1141665994_1141665996 -8 Left 1141665994 16:85465384-85465406 CCATCTGGGTTCTCCTTCATTAC No data
Right 1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141665996 Original CRISPR TTCATTACTGCTGTGTGACT TGG Intergenic
No off target data available for this crispr