ID: 1141667465

View in Genome Browser
Species Human (GRCh38)
Location 16:85473318-85473340
Sequence GGGCAGGGCCAGGAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141667461_1141667465 -9 Left 1141667461 16:85473304-85473326 CCAAGTTAGTGCAGGGGCAGGGC No data
Right 1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141667465 Original CRISPR GGGCAGGGCCAGGAGCTGGT GGG Intergenic
No off target data available for this crispr