ID: 1141670905

View in Genome Browser
Species Human (GRCh38)
Location 16:85491262-85491284
Sequence GTGAAGAAACAGATTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141670905_1141670908 9 Left 1141670905 16:85491262-85491284 CCAGGATCAATCTGTTTCTTCAC No data
Right 1141670908 16:85491294-85491316 ACTGAGCACCTACCAGCACCTGG No data
1141670905_1141670915 29 Left 1141670905 16:85491262-85491284 CCAGGATCAATCTGTTTCTTCAC No data
Right 1141670915 16:85491314-85491336 TGGGGTGCCCTGGAGCCACGAGG No data
1141670905_1141670912 19 Left 1141670905 16:85491262-85491284 CCAGGATCAATCTGTTTCTTCAC No data
Right 1141670912 16:85491304-85491326 TACCAGCACCTGGGGTGCCCTGG No data
1141670905_1141670910 11 Left 1141670905 16:85491262-85491284 CCAGGATCAATCTGTTTCTTCAC No data
Right 1141670910 16:85491296-85491318 TGAGCACCTACCAGCACCTGGGG No data
1141670905_1141670909 10 Left 1141670905 16:85491262-85491284 CCAGGATCAATCTGTTTCTTCAC No data
Right 1141670909 16:85491295-85491317 CTGAGCACCTACCAGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141670905 Original CRISPR GTGAAGAAACAGATTGATCC TGG (reversed) Intergenic
No off target data available for this crispr