ID: 1141673304

View in Genome Browser
Species Human (GRCh38)
Location 16:85504187-85504209
Sequence TTGGTGAAGTGGGCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141673296_1141673304 -2 Left 1141673296 16:85504166-85504188 CCCCGCTCAGCAGAGGGAATCTT No data
Right 1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG No data
1141673297_1141673304 -3 Left 1141673297 16:85504167-85504189 CCCGCTCAGCAGAGGGAATCTTG No data
Right 1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG No data
1141673298_1141673304 -4 Left 1141673298 16:85504168-85504190 CCGCTCAGCAGAGGGAATCTTGG No data
Right 1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141673304 Original CRISPR TTGGTGAAGTGGGCTGAGGA GGG Intergenic
No off target data available for this crispr