ID: 1141673895

View in Genome Browser
Species Human (GRCh38)
Location 16:85507429-85507451
Sequence GTAACCCTGCGGTCCCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141673895_1141673904 14 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673904 16:85507466-85507488 TGGGTGCTGCATTCTTCTGTTGG No data
1141673895_1141673907 25 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673907 16:85507477-85507499 TTCTTCTGTTGGGGCTGCCATGG No data
1141673895_1141673899 -5 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673899 16:85507447-85507469 GTTACTCGCCCTTGCCCAGTGGG No data
1141673895_1141673906 16 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673906 16:85507468-85507490 GGTGCTGCATTCTTCTGTTGGGG No data
1141673895_1141673898 -6 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673898 16:85507446-85507468 GGTTACTCGCCCTTGCCCAGTGG No data
1141673895_1141673905 15 Left 1141673895 16:85507429-85507451 CCCATTTGGGACCGCAGGGTTAC No data
Right 1141673905 16:85507467-85507489 GGGTGCTGCATTCTTCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141673895 Original CRISPR GTAACCCTGCGGTCCCAAAT GGG (reversed) Intergenic
No off target data available for this crispr