ID: 1141674134

View in Genome Browser
Species Human (GRCh38)
Location 16:85508689-85508711
Sequence GCTGCTTGTGCTCAGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141674131_1141674134 3 Left 1141674131 16:85508663-85508685 CCAGATACAGCCTCGGAGGGGAG No data
Right 1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG No data
1141674133_1141674134 -7 Left 1141674133 16:85508673-85508695 CCTCGGAGGGGAGGCTGCTGCTT No data
Right 1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG No data
1141674130_1141674134 4 Left 1141674130 16:85508662-85508684 CCCAGATACAGCCTCGGAGGGGA No data
Right 1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG No data
1141674125_1141674134 29 Left 1141674125 16:85508637-85508659 CCTCGTGGACACGTGGCAATAGT No data
Right 1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141674134 Original CRISPR GCTGCTTGTGCTCAGTATGC TGG Intergenic
No off target data available for this crispr