ID: 1141675442

View in Genome Browser
Species Human (GRCh38)
Location 16:85515066-85515088
Sequence ACGTGTGCACACACATCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141675442_1141675447 0 Left 1141675442 16:85515066-85515088 CCTATGGATGTGTGTGCACACGT No data
Right 1141675447 16:85515089-85515111 GTCAGGGGTGCTCCGCCTCCGGG No data
1141675442_1141675449 9 Left 1141675442 16:85515066-85515088 CCTATGGATGTGTGTGCACACGT No data
Right 1141675449 16:85515098-85515120 GCTCCGCCTCCGGGGAGCCCAGG No data
1141675442_1141675446 -1 Left 1141675442 16:85515066-85515088 CCTATGGATGTGTGTGCACACGT No data
Right 1141675446 16:85515088-85515110 TGTCAGGGGTGCTCCGCCTCCGG No data
1141675442_1141675448 1 Left 1141675442 16:85515066-85515088 CCTATGGATGTGTGTGCACACGT No data
Right 1141675448 16:85515090-85515112 TCAGGGGTGCTCCGCCTCCGGGG No data
1141675442_1141675451 12 Left 1141675442 16:85515066-85515088 CCTATGGATGTGTGTGCACACGT No data
Right 1141675451 16:85515101-85515123 CCGCCTCCGGGGAGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141675442 Original CRISPR ACGTGTGCACACACATCCAT AGG (reversed) Intergenic
No off target data available for this crispr