ID: 1141676433 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:85520195-85520217 |
| Sequence | CTGTATCCTCACATGGTGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141676429_1141676433 | -4 | Left | 1141676429 | 16:85520176-85520198 | CCTGGATGGTGCCCTCTCGCTGT | No data | ||
| Right | 1141676433 | 16:85520195-85520217 | CTGTATCCTCACATGGTGAAAGG | No data | ||||
| 1141676428_1141676433 | 6 | Left | 1141676428 | 16:85520166-85520188 | CCTCGTGGTTCCTGGATGGTGCC | No data | ||
| Right | 1141676433 | 16:85520195-85520217 | CTGTATCCTCACATGGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141676433 | Original CRISPR | CTGTATCCTCACATGGTGAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||