ID: 1141676433

View in Genome Browser
Species Human (GRCh38)
Location 16:85520195-85520217
Sequence CTGTATCCTCACATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141676429_1141676433 -4 Left 1141676429 16:85520176-85520198 CCTGGATGGTGCCCTCTCGCTGT No data
Right 1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG No data
1141676428_1141676433 6 Left 1141676428 16:85520166-85520188 CCTCGTGGTTCCTGGATGGTGCC No data
Right 1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141676433 Original CRISPR CTGTATCCTCACATGGTGAA AGG Intergenic
No off target data available for this crispr