ID: 1141678773

View in Genome Browser
Species Human (GRCh38)
Location 16:85531737-85531759
Sequence GGCCATCCGGTCCATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141678773_1141678794 27 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678794 16:85531787-85531809 AGGGGCCAGGTGCTGGGCGCAGG No data
1141678773_1141678789 8 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678789 16:85531768-85531790 TGAGACAATGGGCTCAGGGAGGG No data
1141678773_1141678781 -3 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678781 16:85531757-85531779 GCCCCGGGTCCTGAGACAATGGG No data
1141678773_1141678786 4 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678786 16:85531764-85531786 GTCCTGAGACAATGGGCTCAGGG No data
1141678773_1141678793 21 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678793 16:85531781-85531803 TCAGGGAGGGGCCAGGTGCTGGG No data
1141678773_1141678792 20 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678792 16:85531780-85531802 CTCAGGGAGGGGCCAGGTGCTGG No data
1141678773_1141678785 3 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678785 16:85531763-85531785 GGTCCTGAGACAATGGGCTCAGG No data
1141678773_1141678780 -4 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678780 16:85531756-85531778 GGCCCCGGGTCCTGAGACAATGG No data
1141678773_1141678790 9 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678790 16:85531769-85531791 GAGACAATGGGCTCAGGGAGGGG No data
1141678773_1141678788 7 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678788 16:85531767-85531789 CTGAGACAATGGGCTCAGGGAGG No data
1141678773_1141678791 14 Left 1141678773 16:85531737-85531759 CCCCCAGGATGGACCGGATGGCC No data
Right 1141678791 16:85531774-85531796 AATGGGCTCAGGGAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141678773 Original CRISPR GGCCATCCGGTCCATCCTGG GGG (reversed) Intergenic
No off target data available for this crispr