ID: 1141680596

View in Genome Browser
Species Human (GRCh38)
Location 16:85541555-85541577
Sequence TTGTCCACGGAGTGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141680596_1141680606 5 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680606 16:85541583-85541605 GGCCACGGGCACATCACAGAGGG No data
1141680596_1141680603 -10 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680603 16:85541568-85541590 CCGTGGACAAGGCAGGGCCACGG No data
1141680596_1141680605 4 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680605 16:85541582-85541604 GGGCCACGGGCACATCACAGAGG No data
1141680596_1141680608 22 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680608 16:85541600-85541622 AGAGGGTTCGCTTCTGTGCCTGG No data
1141680596_1141680609 23 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680609 16:85541601-85541623 GAGGGTTCGCTTCTGTGCCTGGG No data
1141680596_1141680604 -9 Left 1141680596 16:85541555-85541577 CCTGCCAGCCACTCCGTGGACAA No data
Right 1141680604 16:85541569-85541591 CGTGGACAAGGCAGGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141680596 Original CRISPR TTGTCCACGGAGTGGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr