ID: 1141683707

View in Genome Browser
Species Human (GRCh38)
Location 16:85558221-85558243
Sequence CAGATCCTCATGCTGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141683702_1141683707 -3 Left 1141683702 16:85558201-85558223 CCCTTTAGCCCAAAATGAAACAG No data
Right 1141683707 16:85558221-85558243 CAGATCCTCATGCTGTATCTGGG No data
1141683703_1141683707 -4 Left 1141683703 16:85558202-85558224 CCTTTAGCCCAAAATGAAACAGA No data
Right 1141683707 16:85558221-85558243 CAGATCCTCATGCTGTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141683707 Original CRISPR CAGATCCTCATGCTGTATCT GGG Intergenic
No off target data available for this crispr