ID: 1141684707

View in Genome Browser
Species Human (GRCh38)
Location 16:85563645-85563667
Sequence GCTCCCTCCCACAGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141684702_1141684707 7 Left 1141684702 16:85563615-85563637 CCCTGAAGGATCCGGGCAGCTCC No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684701_1141684707 12 Left 1141684701 16:85563610-85563632 CCAGGCCCTGAAGGATCCGGGCA No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684694_1141684707 25 Left 1141684694 16:85563597-85563619 CCCTGCCGGAAGCCCAGGCCCTG No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684703_1141684707 6 Left 1141684703 16:85563616-85563638 CCTGAAGGATCCGGGCAGCTCCA No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684704_1141684707 -4 Left 1141684704 16:85563626-85563648 CCGGGCAGCTCCATCCTCTGCTC No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684695_1141684707 24 Left 1141684695 16:85563598-85563620 CCTGCCGGAAGCCCAGGCCCTGA No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684700_1141684707 13 Left 1141684700 16:85563609-85563631 CCCAGGCCCTGAAGGATCCGGGC No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data
1141684697_1141684707 20 Left 1141684697 16:85563602-85563624 CCGGAAGCCCAGGCCCTGAAGGA No data
Right 1141684707 16:85563645-85563667 GCTCCCTCCCACAGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141684707 Original CRISPR GCTCCCTCCCACAGTGAGAC AGG Intergenic
No off target data available for this crispr