ID: 1141687853

View in Genome Browser
Species Human (GRCh38)
Location 16:85580503-85580525
Sequence GGGTCTAAACCCAGTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141687853_1141687863 27 Left 1141687853 16:85580503-85580525 CCAGAGAGACTGGGTTTAGACCC No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687853_1141687864 28 Left 1141687853 16:85580503-85580525 CCAGAGAGACTGGGTTTAGACCC No data
Right 1141687864 16:85580554-85580576 GGACACCGCAGCCTCCTGTTGGG No data
1141687853_1141687856 6 Left 1141687853 16:85580503-85580525 CCAGAGAGACTGGGTTTAGACCC No data
Right 1141687856 16:85580532-85580554 GACATGCCCCAGCGATGCCCAGG No data
1141687853_1141687857 7 Left 1141687853 16:85580503-85580525 CCAGAGAGACTGGGTTTAGACCC No data
Right 1141687857 16:85580533-85580555 ACATGCCCCAGCGATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141687853 Original CRISPR GGGTCTAAACCCAGTCTCTC TGG (reversed) Intergenic
No off target data available for this crispr