ID: 1141687855

View in Genome Browser
Species Human (GRCh38)
Location 16:85580524-85580546
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141687855_1141687868 20 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687868 16:85580567-85580589 TCCTGTTGGGTCACAAGGCCTGG No data
1141687855_1141687864 7 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687864 16:85580554-85580576 GGACACCGCAGCCTCCTGTTGGG No data
1141687855_1141687870 26 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687870 16:85580573-85580595 TGGGTCACAAGGCCTGGCTGTGG No data
1141687855_1141687871 29 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687871 16:85580576-85580598 GTCACAAGGCCTGGCTGTGGTGG No data
1141687855_1141687866 15 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687866 16:85580562-85580584 CAGCCTCCTGTTGGGTCACAAGG No data
1141687855_1141687863 6 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141687855 Original CRISPR TCGCTGGGGCATGTCTCAAA TGG (reversed) Intergenic
No off target data available for this crispr