ID: 1141687863

View in Genome Browser
Species Human (GRCh38)
Location 16:85580553-85580575
Sequence GGGACACCGCAGCCTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141687855_1141687863 6 Left 1141687855 16:85580524-85580546 CCATTTGAGACATGCCCCAGCGA No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687853_1141687863 27 Left 1141687853 16:85580503-85580525 CCAGAGAGACTGGGTTTAGACCC No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687860_1141687863 -10 Left 1141687860 16:85580540-85580562 CCAGCGATGCCCAGGGACACCGC No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687859_1141687863 -9 Left 1141687859 16:85580539-85580561 CCCAGCGATGCCCAGGGACACCG No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687858_1141687863 -8 Left 1141687858 16:85580538-85580560 CCCCAGCGATGCCCAGGGACACC No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data
1141687854_1141687863 7 Left 1141687854 16:85580523-85580545 CCCATTTGAGACATGCCCCAGCG No data
Right 1141687863 16:85580553-85580575 GGGACACCGCAGCCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141687863 Original CRISPR GGGACACCGCAGCCTCCTGT TGG Intergenic
No off target data available for this crispr