ID: 1141688890

View in Genome Browser
Species Human (GRCh38)
Location 16:85585543-85585565
Sequence GCCCAGCTGGGTCTCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141688881_1141688890 22 Left 1141688881 16:85585498-85585520 CCAAACACTCGCTTTGGCACGTG No data
Right 1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG No data
1141688886_1141688890 -5 Left 1141688886 16:85585525-85585547 CCTTTGGGGTGTCTTTCTGCCCA No data
Right 1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141688890 Original CRISPR GCCCAGCTGGGTCTCCATGT GGG Intergenic
No off target data available for this crispr