ID: 1141689106

View in Genome Browser
Species Human (GRCh38)
Location 16:85586599-85586621
Sequence CTGCTCCTACAACGTGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141689101_1141689106 10 Left 1141689101 16:85586566-85586588 CCCACTGCCAGGCCGCATGGCCA No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689103_1141689106 3 Left 1141689103 16:85586573-85586595 CCAGGCCGCATGGCCAAGAGTCG No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689105_1141689106 -10 Left 1141689105 16:85586586-85586608 CCAAGAGTCGCAGCTGCTCCTAC No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689099_1141689106 18 Left 1141689099 16:85586558-85586580 CCAGCTGTCCCACTGCCAGGCCG No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689096_1141689106 28 Left 1141689096 16:85586548-85586570 CCGGGCCACACCAGCTGTCCCAC No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689102_1141689106 9 Left 1141689102 16:85586567-85586589 CCACTGCCAGGCCGCATGGCCAA No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689104_1141689106 -2 Left 1141689104 16:85586578-85586600 CCGCATGGCCAAGAGTCGCAGCT No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data
1141689097_1141689106 23 Left 1141689097 16:85586553-85586575 CCACACCAGCTGTCCCACTGCCA No data
Right 1141689106 16:85586599-85586621 CTGCTCCTACAACGTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141689106 Original CRISPR CTGCTCCTACAACGTGCTCA CGG Intergenic
No off target data available for this crispr