ID: 1141689115

View in Genome Browser
Species Human (GRCh38)
Location 16:85586636-85586658
Sequence CACGGCAGTCGGGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141689115_1141689125 -3 Left 1141689115 16:85586636-85586658 CCCGCGCCCCCCCGACTGCCGTG No data
Right 1141689125 16:85586656-85586678 GTGCTCCATGGCTTCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141689115 Original CRISPR CACGGCAGTCGGGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr