ID: 1141691022

View in Genome Browser
Species Human (GRCh38)
Location 16:85596171-85596193
Sequence TTCGAGCTGCGATGCAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141691022_1141691026 15 Left 1141691022 16:85596171-85596193 CCACCGCTGCATCGCAGCTCGAA No data
Right 1141691026 16:85596209-85596231 CTCTTCTCACATCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141691022 Original CRISPR TTCGAGCTGCGATGCAGCGG TGG (reversed) Intergenic
No off target data available for this crispr