ID: 1141694456

View in Genome Browser
Species Human (GRCh38)
Location 16:85613091-85613113
Sequence GCGCGCGCGCGCGCACCGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 10, 3: 25, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141694456_1141694458 -9 Left 1141694456 16:85613091-85613113 CCCGTCGGTGCGCGCGCGCGCGC 0: 1
1: 0
2: 10
3: 25
4: 155
Right 1141694458 16:85613105-85613127 CGCGCGCGCCTGTGTGTTTGCGG 0: 1
1: 0
2: 5
3: 23
4: 124
1141694456_1141694466 27 Left 1141694456 16:85613091-85613113 CCCGTCGGTGCGCGCGCGCGCGC 0: 1
1: 0
2: 10
3: 25
4: 155
Right 1141694466 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 29
4: 211
1141694456_1141694463 21 Left 1141694456 16:85613091-85613113 CCCGTCGGTGCGCGCGCGCGCGC 0: 1
1: 0
2: 10
3: 25
4: 155
Right 1141694463 16:85613135-85613157 CCGACACCTCCCGCTGGCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1141694456_1141694460 15 Left 1141694456 16:85613091-85613113 CCCGTCGGTGCGCGCGCGCGCGC 0: 1
1: 0
2: 10
3: 25
4: 155
Right 1141694460 16:85613129-85613151 TGAAACCCGACACCTCCCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 33
1141694456_1141694464 26 Left 1141694456 16:85613091-85613113 CCCGTCGGTGCGCGCGCGCGCGC 0: 1
1: 0
2: 10
3: 25
4: 155
Right 1141694464 16:85613140-85613162 ACCTCCCGCTGGCTGAGGTCAGG 0: 1
1: 0
2: 2
3: 18
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141694456 Original CRISPR GCGCGCGCGCGCGCACCGAC GGG (reversed) Intronic
900366876 1:2315090-2315112 GGGCGGCCGCGCCCACCGACGGG - Intergenic
902348428 1:15835918-15835940 GCGCGCGCGCGCTCGCCGTGCGG + Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
915902105 1:159854743-159854765 GCGCGCGCGCTCACACCAAGAGG + Exonic
916651659 1:166839598-166839620 GCCCGCGCGCACTCACCGCCGGG - Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
920524995 1:206659789-206659811 GTGCGCGCGCACGCACCGGGTGG - Intronic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065216799 10:23457012-23457034 GCGCGCGCGCGCACAGAGAATGG + Intergenic
1066094148 10:32056480-32056502 GTGCGAGCGCGCGCACCGATTGG - Intergenic
1068669669 10:59710065-59710087 GCGCGTGTGTGCGCACCGAGAGG - Exonic
1070032638 10:72692295-72692317 GGGCGCGCTCGCTCACCGTCCGG - Exonic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1074618344 10:115093038-115093060 GCGCGCGCGCCCACCCCGCCTGG - Intergenic
1075801986 10:125159837-125159859 GCCCCCGGGCGCGCACCCACCGG + Intronic
1076579534 10:131497448-131497470 GCGCGCGCGCACACACACACTGG + Intergenic
1076793405 10:132787901-132787923 GCGCGCGCGGGCGGAACGGCGGG + Intergenic
1076909146 10:133378887-133378909 GGACGCTCGCGCGCACCGCCCGG + Intergenic
1077074862 11:695765-695787 GCGCGAGCGCGCGGGCCGAGAGG + Exonic
1077254680 11:1574818-1574840 GAGGGCGCGCGCGAACCGCCGGG - Intergenic
1077492700 11:2869562-2869584 GCGGGCGCGGGCGCACCGTCGGG + Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1085485643 11:76860871-76860893 GCGCTCGCTCGCGCCCCGCCCGG - Exonic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1088820485 11:113452474-113452496 GCGCGCGCGCGCGCACATTGGGG + Intronic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1089622397 11:119729308-119729330 GCGTGCGCTCGGGCTCCGACCGG - Intergenic
1091108472 11:132943913-132943935 GCGCGCGGGCCCGGACCGCCGGG + Intronic
1091286635 11:134411973-134411995 GCGCGCCCGCCCGCCCCGCCCGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1093711725 12:22335312-22335334 GGGCGCGCGCGCACACACACGGG - Intronic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096700562 12:53380345-53380367 GGGCGCGCGCGAGGGCCGACCGG + Intronic
1097218365 12:57431153-57431175 GCGAGTGCGCGCGCGCCGGCGGG - Intergenic
1098369190 12:69739079-69739101 GCGGGCGCGCGGGCGCCGAGGGG - Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1102084397 12:110124285-110124307 CCGCGCGCGCGCGCACGAGCTGG - Intergenic
1102475542 12:113185926-113185948 GCCCCCGCGCCCTCACCGACGGG + Exonic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1117899253 14:60515578-60515600 GCGCGCGCCCGCCCACCCTCGGG + Intergenic
1118925547 14:70187869-70187891 GCACGCGGGCGCGCGCCGAGTGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1122300159 14:100726953-100726975 GGGCGCGGGCGCGCAGCGAGGGG - Exonic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1123004402 14:105314508-105314530 GCGCGCTCTCGCGCACCGGCGGG + Exonic
1123040330 14:105487712-105487734 CCGCGCCCGCGCGCCCCGAGGGG + Intronic
1124696694 15:31870106-31870128 ACGCGCGCGCACGGACCGAGGGG + Intronic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131144602 15:90002559-90002581 GCGCGGGCTCGGGGACCGACGGG + Intronic
1131558492 15:93419561-93419583 GCGCGCGCGCGCGCAACCCAGGG - Intergenic
1132926006 16:2429422-2429444 GAGCGCGCCCGCGCCCCGGCCGG - Exonic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1136141601 16:28292410-28292432 GCGCGAGGGCGCGCGCCGAGCGG + Intergenic
1136462135 16:30418148-30418170 GCGTGCGCGCGTGCTCCGCCAGG - Exonic
1136531877 16:30875361-30875383 GCGCGCGCCCGCGCCCCAACCGG + Intronic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1139534215 16:67561988-67562010 GGGAGCGCGCGGGAACCGACCGG + Intergenic
1141116612 16:81315015-81315037 GCGCGCGCGCCCGCCCGGCCCGG - Exonic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1142795479 17:2303797-2303819 GCGCGCGCTCGCCCACCTCCCGG + Exonic
1142863395 17:2776769-2776791 GCGCACGCGCGCACCCCGGCCGG - Intergenic
1143495035 17:7307899-7307921 GCGCGGGCGCGCGCCCCGGTTGG + Intronic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1147967248 17:44199834-44199856 GCGCGCGCGTGTGCCGCGACCGG + Intronic
1152356752 17:79811276-79811298 GCGCGTGCGCGCGCCTCGGCGGG - Intergenic
1152417680 17:80173330-80173352 GCGCGCGCGCGCGGAATGACAGG + Intronic
1152852975 17:82648517-82648539 GCGCGCGCCCGCGCCCCACCAGG + Exonic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1155054497 18:22171797-22171819 GCGCGGGCGCGCACCCCGGCTGG + Exonic
1156099774 18:33578849-33578871 GCGCGCGCACGCACACACACAGG - Intronic
1160452404 18:78974343-78974365 ACGCGCGCACTCGCACGGACGGG + Intergenic
1160736040 19:662859-662881 GGGTTCGCGCGCGCACCGCCCGG + Intronic
1161022833 19:2018940-2018962 GCACGCGTGCGCGCACACACAGG + Intronic
1161764551 19:6199534-6199556 GCGCGCAGGCGCGGACCGCCTGG - Intronic
1161802585 19:6424402-6424424 GCTCGCGCGCGCGCGCAGGCGGG - Intronic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163559022 19:18008181-18008203 GCGCAGGCGCGCTCACCAACCGG - Exonic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1165080222 19:33302504-33302526 GCCCGCGCCCGCGCACCTCCGGG + Exonic
1165812307 19:38618888-38618910 GCGTGCGCGCGCGAACTCACCGG - Intergenic
925927839 2:8682942-8682964 GCGCGCGCACACACACCGAGGGG - Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
930872692 2:56184415-56184437 GCGCGCGCCCGCGCTCCCCCAGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
944675549 2:202032665-202032687 GCGCGCGAGCGCCCAGCGCCTGG + Intergenic
945033360 2:205684942-205684964 GCGCGCGAGCGCGCACACACTGG + Intronic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
946621883 2:221571136-221571158 GCACGCGCGCGCACACACACAGG + Intronic
947119238 2:226799131-226799153 GCGCGCGCGCGCGCTCCTGGAGG - Exonic
948118862 2:235514139-235514161 GCGCGCGCACGCGCATGCACTGG - Intronic
948910071 2:240998500-240998522 GCGCGCCCGCGCCCTCCCACGGG + Intergenic
1169673783 20:8132446-8132468 GCGCGCGGGGGCGCAGCGCCCGG - Intronic
1170999136 20:21396315-21396337 GCTCGCGCTCGGGCGCCGACAGG + Exonic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172841291 20:37903945-37903967 GCGCGCGCGCACACACACACAGG + Intronic
1175992410 20:62796427-62796449 GGGCGGGCGCGCGCTCCGCCGGG - Intergenic
1176178534 20:63739513-63739535 GCGCGCCCGCGCGCCCCGCCGGG - Intronic
1176242077 20:64079848-64079870 GAGTGCGCGCGCGCAGCGCCGGG - Intronic
1176547222 21:8207223-8207245 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176547737 21:8208834-8208856 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1176555127 21:8251432-8251454 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176566173 21:8390270-8390292 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176574047 21:8434456-8434478 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1176574564 21:8436068-8436090 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1176611176 21:8987360-8987382 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1180796832 22:18610000-18610022 GCGCGCTCGCCTGCTCCGACAGG + Exonic
1181224892 22:21385271-21385293 GCGCGCTCGCCTGCTCCGACAGG - Exonic
1181253740 22:21549542-21549564 GCGCGCTCGCCTGCTCCGACAGG + Exonic
1183154744 22:36066307-36066329 GAGGGCGCGCGCGCACGGCCAGG + Intergenic
1184184822 22:42857407-42857429 GCGCACGCGCGTGCAGCGCCTGG - Intronic
1203252095 22_KI270733v1_random:123508-123530 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203252611 22_KI270733v1_random:125119-125141 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1203260149 22_KI270733v1_random:168591-168613 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203260667 22_KI270733v1_random:170205-170227 GGGCGCACGCGCGCGCCGAACGG - Intergenic
950683877 3:14602887-14602909 CCGCGCGCGCGCTCACCGGCCGG + Intergenic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
954558748 3:51538653-51538675 GCGCGCCCGACCGCACGGACGGG - Intergenic
956089292 3:65648319-65648341 GCGTGCGCGTGCACACAGACAGG + Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
956798794 3:72738859-72738881 GCGCGTGCGCGCGGACCGGGCGG - Intergenic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
968584074 4:1407848-1407870 GCGCGGGCGCGTGCACCGGCGGG + Intergenic
968775483 4:2537117-2537139 GCGCTCGCGCCCGCGCCGAGAGG - Intronic
969362632 4:6674323-6674345 GCGCGCCCGGGCGCACTGGCGGG + Intergenic
970394841 4:15655391-15655413 GACCGGGCGCGCGCGCCGACGGG - Exonic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
982460808 4:155667251-155667273 GCACTCGCGCGGGGACCGACAGG + Intronic
984024119 4:174522525-174522547 GCGCGCGCGCGCGTGCAGCCCGG + Exonic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998143250 5:139711411-139711433 GTGTGCGCGCGCGCTCCGAGGGG + Intergenic
998963272 5:147510197-147510219 GCGCGCGCACACGCACACACAGG + Intergenic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1015965668 6:138693348-138693370 GCGCCCGCACCCGCCCCGACAGG - Intergenic
1018329954 6:162716751-162716773 GCGTGCGCGCGCGCGCAGGCGGG - Intronic
1018400138 6:163413978-163414000 GCGCGCTCGCGGGGCCCGACGGG + Intronic
1020066219 7:5190374-5190396 GCGCGCGCGCCCTCCCCGGCCGG + Exonic
1026822303 7:73557691-73557713 TCGCGCACGCGCGCACGGAGGGG - Exonic
1026822319 7:73557757-73557779 GCGCGCCTGCGCGCCCCGCCCGG + Exonic
1031689095 7:124765898-124765920 TCGCGGGCGCGCGCAGCGGCTGG - Intergenic
1032013410 7:128360966-128360988 GCGCGCGCGCGTGCAGGGGCAGG - Intronic
1035153162 7:156892486-156892508 GCGCGGGGGCGCGCACTGGCGGG + Intronic
1037878413 8:22560873-22560895 GCGCGCGCGCACGCGCCGTGGGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038554012 8:28494155-28494177 ACGAGCGCGCGCGCACGCACGGG - Intergenic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1039903129 8:41767187-41767209 GCGCGCGCACCCGCACCCGCCGG + Intronic
1041369475 8:57143518-57143540 GCGCACGGGCGCGCACGGGCTGG + Intergenic
1041690362 8:60680330-60680352 GCGGGGGCGCGGGCACCGGCTGG + Intronic
1042962950 8:74321715-74321737 GGGCGCGCGCGGGGACCGGCTGG + Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1049585362 8:143430419-143430441 GCGCCCGGCCGCGCCCCGACGGG + Intergenic
1057432224 9:95004921-95004943 GCGGGCGGGCGGGCACCGAGCGG - Intronic
1057600032 9:96450077-96450099 GCGCACCCGCGCGCGCTGACTGG + Intergenic
1057708005 9:97411913-97411935 GCGCGTGCCCACGCACCGGCCGG - Intergenic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1061299691 9:129697530-129697552 GCGCGCTCGCACGCACTGGCTGG + Intronic
1062306032 9:135907533-135907555 GCGGGAGCGCGCTCACCGCCGGG + Intergenic
1062696511 9:137878601-137878623 GCGCACGCACGCGCAGCGCCAGG - Intronic
1203468498 Un_GL000220v1:106658-106680 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203469015 Un_GL000220v1:108270-108292 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203476319 Un_GL000220v1:150630-150652 GCGCGCACGCGCGCACCGGCCGG + Intergenic
1203476836 Un_GL000220v1:152242-152264 GGGCGCACGCGCGCGCCGAACGG - Intergenic
1190096117 X:47482592-47482614 GCGCACGCGCACGCACGCACCGG - Exonic
1199086452 X:143634722-143634744 GCGCGCGCACGCGAGCCGAGGGG - Intronic
1200093839 X:153648127-153648149 GCAGGAGCGCGCGCACCGACAGG - Exonic