ID: 1141694465

View in Genome Browser
Species Human (GRCh38)
Location 16:85613141-85613163
Sequence CCCTGACCTCAGCCAGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 239}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141694465_1141694481 24 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694481 16:85613188-85613210 GGAGTGGGCGGCGTTGCGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 54
1141694465_1141694471 -3 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694471 16:85613161-85613183 GGGAGCCGGGAGCGAGCCAGTGG 0: 1
1: 0
2: 2
3: 43
4: 322
1141694465_1141694475 8 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694475 16:85613172-85613194 GCGAGCCAGTGGCCCGGGAGTGG 0: 1
1: 0
2: 1
3: 14
4: 229
1141694465_1141694476 9 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694476 16:85613173-85613195 CGAGCCAGTGGCCCGGGAGTGGG 0: 1
1: 1
2: 2
3: 18
4: 150
1141694465_1141694477 12 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694477 16:85613176-85613198 GCCAGTGGCCCGGGAGTGGGCGG 0: 1
1: 0
2: 4
3: 33
4: 430
1141694465_1141694482 25 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694482 16:85613189-85613211 GAGTGGGCGGCGTTGCGTTTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1141694465_1141694474 3 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694474 16:85613167-85613189 CGGGAGCGAGCCAGTGGCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 344
1141694465_1141694473 2 Left 1141694465 16:85613141-85613163 CCTCCCGCTGGCTGAGGTCAGGG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1141694473 16:85613166-85613188 CCGGGAGCGAGCCAGTGGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141694465 Original CRISPR CCCTGACCTCAGCCAGCGGG AGG (reversed) Intronic
900114565 1:1022993-1023015 CCCTGACCCCAGCCTGGTGGGGG + Intronic
900522752 1:3113535-3113557 CCGAGGCCTGAGCCAGCGGGAGG + Intronic
900622049 1:3592019-3592041 GCCTGACCTGAGCCAGCATGTGG - Intronic
901137604 1:7007975-7007997 CCCTGTCCTCATCCAGTGGGAGG + Intronic
901602016 1:10429981-10430003 CCGTGACCTCATTCAGCGAGTGG - Intergenic
902405982 1:16183844-16183866 CTCTCACCTCAGCCAGCCCGGGG - Intergenic
902580581 1:17405065-17405087 CCCTGTCCTCAGCCAGGGGCAGG + Intergenic
902956086 1:19924862-19924884 CCCTGACCCCAACCAGCCGGAGG + Intergenic
904017281 1:27431869-27431891 CACTTACCACAACCAGCGGGAGG + Intronic
906495897 1:46303578-46303600 CCCTAACCTCTGCCTGCGGCTGG + Exonic
907451374 1:54547871-54547893 CCCTGATCCCAGCCAGCAGATGG - Intronic
907933445 1:59020762-59020784 CCCTGACCTCAGCAAGCTCATGG - Intergenic
908251579 1:62270103-62270125 GCCTGACCTCAGCCTGTTGGAGG + Intronic
908762391 1:67524231-67524253 CCTTGACCTCAGACAAGGGGAGG - Intergenic
909827438 1:80143327-80143349 TCCTGACCTCAGACCCCGGGAGG - Intergenic
910758916 1:90717078-90717100 TCCTGGCCTCACCGAGCGGGCGG + Exonic
912700734 1:111876519-111876541 CCCTGACTTCAGCCAGTGGGCGG + Intronic
914004096 1:143717604-143717626 CCCGGACCTGAGCCACCTGGGGG + Intergenic
917897499 1:179505880-179505902 GTCTGACCTCATACAGCGGGAGG + Intronic
918241495 1:182624165-182624187 CCCTGTCCTCAGGGAGCTGGAGG - Intergenic
919765822 1:201126899-201126921 CCGTAACCCCAGCCAGCAGGTGG + Intronic
922674611 1:227542711-227542733 CCCTGGTGGCAGCCAGCGGGAGG + Intergenic
922730582 1:227947056-227947078 CCCAGACCTCAGAGAGGGGGAGG + Intronic
922764248 1:228149300-228149322 CCCTGAGCTCTGGCAGCTGGAGG + Intergenic
924772247 1:247088370-247088392 CCCTGACGTCAGGCAGAGGCAGG + Intergenic
1065798562 10:29330032-29330054 CTTTGACCTCAGCCAGCCGGTGG - Intergenic
1067167887 10:43879816-43879838 CGCTGACCACAGCCAGGGGAGGG + Intergenic
1067669076 10:48303279-48303301 CCCTGACCTCACCCCAGGGGTGG - Intergenic
1067776281 10:49167111-49167133 GGCTGGCCTCAGCCAGTGGGAGG - Intronic
1069570146 10:69489837-69489859 CCCTGACCCCAGCCAGGGGCTGG + Intronic
1069858917 10:71458081-71458103 CCGTCTCCTCAGCCAGCTGGAGG - Intronic
1070779531 10:79129563-79129585 CCCTCCCCTCTGCCAGCAGGAGG + Intronic
1070784992 10:79157690-79157712 CCCTGACCTCACCAAGCTGGGGG - Intronic
1070815420 10:79319727-79319749 CCCTGACCTGACCCACAGGGAGG - Intergenic
1071847648 10:89536139-89536161 CCCTGACCTCGGCAAGCCGAGGG + Intronic
1072759660 10:98045964-98045986 GGCTGCCCTCAGCCAGCAGGGGG - Intergenic
1072788975 10:98303745-98303767 GCCTGAGCTCAGGCAGCAGGAGG + Intergenic
1072860020 10:98994128-98994150 CCTTGAACTCAGCCTGAGGGTGG + Intronic
1073127652 10:101161878-101161900 CCCTGAACTCAGGCATCTGGGGG - Intergenic
1074183038 10:111079423-111079445 CGCTGACTGCAGGCAGCGGGGGG + Exonic
1074851851 10:117445392-117445414 CCCTGACCTCAGAGAGAAGGTGG - Intergenic
1076220774 10:128731602-128731624 CCCAGACCTCAGGCAGCGCCTGG - Intergenic
1076385220 10:130050852-130050874 CACTGACCTCAGCCATAGGCAGG + Intergenic
1076495574 10:130895410-130895432 CTCTGACCACAGGCAGCAGGGGG + Intergenic
1076764528 10:132625698-132625720 CCCTGACCTCAGCCAAAGAAAGG - Intronic
1076888066 10:133271593-133271615 CCCTGACCTCAGCCACCTGGTGG - Exonic
1076888988 10:133274897-133274919 CCCTGGGCTCATCCAGCCGGTGG - Intronic
1077020665 11:415881-415903 CCCTGCCCTCAGCCACATGGGGG + Intronic
1077099180 11:813905-813927 CCCACACCAAAGCCAGCGGGTGG - Intergenic
1081611202 11:44564698-44564720 CCCTCACCTCAGGCAGCTGCTGG + Intronic
1083429382 11:62606056-62606078 CCCTCACCTCAGCCTCCTGGAGG + Exonic
1084689319 11:70715952-70715974 CCCTGTCCACAGCCAGAGGCAGG - Intronic
1084954821 11:72685567-72685589 GCCTGATGTGAGCCAGCGGGGGG - Exonic
1085312789 11:75526018-75526040 CCCTGCCCGCAGCCGGCCGGGGG - Intergenic
1085704865 11:78778042-78778064 CCCTGACCTCAGGGAGCAGATGG - Intronic
1088988444 11:114929686-114929708 TCCTGACCTAGGCCAGGGGGAGG + Intergenic
1088999897 11:115043173-115043195 CCCCTACCTCACCCAGCGGCAGG - Intergenic
1089352809 11:117831035-117831057 CCATGACCTGAGCTAGCTGGGGG - Intronic
1090383909 11:126345484-126345506 CGATCACCTCAGCCAGCAGGTGG - Exonic
1091386907 12:101569-101591 CCCTGTCCCCAGCCAGGGGGAGG - Intronic
1091387894 12:106363-106385 CCCCAGCCACAGCCAGCGGGTGG + Intronic
1091749759 12:3014947-3014969 CCCTGACCTCTCCCCGCAGGAGG - Intronic
1091768378 12:3136625-3136647 CCCTGACCTCAGGCATCTGAGGG - Intronic
1092181865 12:6451769-6451791 TCCTGACCTGAGCCAGGAGGCGG - Intronic
1092856070 12:12674952-12674974 CCCTGACCCCAGCCCAGGGGAGG - Intronic
1096526596 12:52213592-52213614 CACTGGCCTGAGCCAGCAGGTGG - Intergenic
1101977227 12:109370216-109370238 CCCTGGCTTCAGCCAGGGAGGGG - Intronic
1102138050 12:110591741-110591763 CCTTGACCTCAGCAGGCAGGCGG + Intergenic
1104854800 12:131896530-131896552 CCCTTCCCTCAGCCAGGGGCTGG - Intronic
1104977990 12:132560673-132560695 CCCTGACCTCCGCCCGCCGCCGG + Intronic
1110101579 13:71612973-71612995 CCCTGCCCTCAGCAAGCTGATGG + Intronic
1112593762 13:100788885-100788907 CCATGACCTTAGCCACCGGCAGG - Intergenic
1113134458 13:107074145-107074167 CCCTGAAATCAGCCCGCTGGTGG + Intergenic
1113604846 13:111597860-111597882 CCCTGACGTGACCCTGCGGGAGG + Intronic
1114415483 14:22540199-22540221 TCCTGCCCTCTGCCAGCTGGGGG - Intergenic
1115770195 14:36659095-36659117 CCCTGGCCTGAGCCAGCTGCAGG + Intronic
1118317923 14:64737047-64737069 CCCTCTCCTCAGCCAGCCAGGGG - Intronic
1118457875 14:65961184-65961206 TGCTGACCTCGGCCAGCAGGAGG + Intronic
1119888233 14:78162366-78162388 CACAGAGCTCAGCCAGCGTGGGG - Intergenic
1119903417 14:78281189-78281211 CACTGACCTCAGCCAGGGCCGGG - Intronic
1122436680 14:101705891-101705913 CCGCGACCGCAGCCGGCGGGGGG + Intergenic
1123588159 15:21777082-21777104 CCCTGTGCCCAGCCAGGGGGTGG - Intergenic
1123624798 15:22219645-22219667 CCCTGTGCCCAGCCAGGGGGTGG - Intergenic
1125713453 15:41805353-41805375 CCTTTTCCTCAGCCAGCTGGTGG + Intronic
1126067060 15:44834077-44834099 CCCTGCTCCCAGCCAGTGGGAGG - Intergenic
1127509075 15:59622517-59622539 CCATCACATCAGCCAGCAGGGGG - Exonic
1127659798 15:61089833-61089855 CCCTGACCTCATCAAGCTGTTGG + Intronic
1129340486 15:74882628-74882650 ACCTGACCTCAGCCAGTGGAAGG + Intergenic
1130559483 15:84946985-84947007 CCCTGACCTAGGGCAGTGGGAGG + Intergenic
1130856106 15:87841414-87841436 CCCTGGGCTCAGCCAGAGGATGG - Intergenic
1132590443 16:724111-724133 CACTGACTTCAGCCATCGGGAGG - Exonic
1132607832 16:800864-800886 CCCTGGGCTCACCCAGCGGATGG + Intergenic
1132717765 16:1300747-1300769 CCCTCACCCCACCCAGCAGGAGG - Intergenic
1132842614 16:1985527-1985549 CCCTGGCCTCAGGCAGAGTGTGG - Intronic
1133695633 16:8259913-8259935 CCCAGACCTCAGCTAGCAAGTGG + Intergenic
1136298697 16:29318820-29318842 CCATGACCACAGCCAGCGGCTGG + Intergenic
1138476342 16:57272510-57272532 CCCTGGCCTCGGCCTGCTGGAGG + Intronic
1139655947 16:68387374-68387396 CCCTCACCTCAGTCAGCAAGGGG - Intronic
1139664860 16:68448346-68448368 CACTGACCTCTGACGGCGGGCGG + Exonic
1141610416 16:85178049-85178071 CCCTGACCTCAGGGTGCTGGTGG + Intronic
1141694465 16:85613141-85613163 CCCTGACCTCAGCCAGCGGGAGG - Intronic
1142060359 16:88025317-88025339 CCATGACCACAGCCAGCGGCTGG + Intronic
1142211271 16:88809787-88809809 CCAGGACCTCAGCCTGCAGGCGG + Exonic
1142273407 16:89102854-89102876 CCCTGACCCCAACCAGCGAAAGG - Intronic
1143384697 17:6521841-6521863 ACCTGACCTCAGCCTGTGGATGG + Intronic
1143618842 17:8069645-8069667 CCTTGAAGTCAGCCAGCTGGTGG - Intergenic
1145257812 17:21337175-21337197 GCCAGACCTCATCCAGCGAGGGG - Intergenic
1148820148 17:50355367-50355389 CCCAGACATCAGCCAGGGGTAGG + Intronic
1151907130 17:77056088-77056110 CCCTGAAGGCAGCCAGCGAGGGG - Intergenic
1152018961 17:77770589-77770611 CCCTGACCTCAGACAGGAGGAGG - Intergenic
1152586703 17:81192583-81192605 CCCTGGCCGCAGGCAGCGGGCGG - Exonic
1152838154 17:82548759-82548781 CCGTGACCTCACCCTGGGGGAGG + Intronic
1153804905 18:8703587-8703609 CCCAGAGCTCAGCCAGGGCGAGG + Intergenic
1155917719 18:31572579-31572601 CCCTGACCTGAGCTCGCGGGAGG - Intergenic
1157219857 18:45820631-45820653 CACGGACCTGAGCCAGCTGGGGG + Intergenic
1159941965 18:74415158-74415180 CCCTGTGCTGAGCCAGAGGGCGG + Intergenic
1160557500 18:79735675-79735697 CCCGAACCTCAGCAGGCGGGAGG - Intronic
1160671222 19:364680-364702 ACATGACCCCAGCCAGGGGGAGG - Intronic
1161388554 19:4009469-4009491 CCCTGCCCTCAGCCAGGGTGGGG - Intronic
1161516067 19:4697364-4697386 TCCTGACCTCAGCCAGTCTGAGG - Intronic
1161602297 19:5191841-5191863 CCTTGTCCACAGCCGGCGGGAGG - Intronic
1161624822 19:5320178-5320200 CCCTGCCCTCTGCCATCCGGCGG + Intronic
1162028733 19:7908429-7908451 CCCTGATCTCAGCCAGTAGGAGG - Intronic
1162332938 19:10041494-10041516 TCCTGACCTCAGTCAGGGGCCGG - Intergenic
1164435405 19:28224319-28224341 CCCTGAGCTAAGGCAGAGGGAGG + Intergenic
1165041045 19:33067777-33067799 CAATGACCTCAGCCAGCAAGGGG - Intergenic
1166104595 19:40591030-40591052 GCCGGGCCTCAGCCTGCGGGGGG - Exonic
1166493712 19:43282903-43282925 CCCTGACTCCAGCCGGGGGGTGG - Intergenic
1166560471 19:43729429-43729451 CCCTGAGCTGGGCCAGCAGGAGG + Exonic
1166751644 19:45166706-45166728 TCCTGAGAGCAGCCAGCGGGAGG - Intronic
1168325602 19:55537078-55537100 CACTGACCACAGCCGGCGGCCGG - Exonic
1168403039 19:56097063-56097085 CCCCGGCCTCAGCCTGCAGGAGG + Intronic
925118280 2:1398496-1398518 CTCAGACCTCACCCAGTGGGCGG + Intronic
927060305 2:19412453-19412475 CCCTGCCCTCACCAAGCTGGGGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
930019767 2:46994428-46994450 CCATGAACTCAGGCAGAGGGTGG - Exonic
931634047 2:64326326-64326348 CCCTGATCTAAACCAGTGGGAGG - Intergenic
933721076 2:85398197-85398219 CCCTCACCTCAGCCTGAGGAGGG + Intronic
934573293 2:95385183-95385205 CCCAAGCCTCAGCCAGCAGGAGG - Exonic
937436308 2:121884700-121884722 CCATGACCTCTGCCTGCAGGCGG - Intergenic
938194872 2:129318803-129318825 CCCTGGGCTCAGCCAGCGCAAGG - Intergenic
939915778 2:148041374-148041396 TCCTGACCTGAGCCAGGGTGGGG - Intronic
940008757 2:149033951-149033973 ACCTCACTCCAGCCAGCGGGCGG - Intergenic
940094074 2:149953602-149953624 CCCTGACCTCAGCCATCCTTGGG - Intergenic
942084459 2:172430804-172430826 CCCTGACCTCAGTCACTCGGCGG - Intronic
948034571 2:234847680-234847702 TCCTCACCACAGCCAGCGGCAGG - Intergenic
948561199 2:238854452-238854474 CACAGACCTCAGCCACAGGGTGG - Intronic
1168813805 20:723095-723117 CACTGACCACAGCCAGAGAGGGG - Intergenic
1169287455 20:4321535-4321557 CCCTGGGCTCAGCCAGAGAGTGG + Intergenic
1170052252 20:12158916-12158938 CACTGTGCTCAGCCAGCAGGTGG + Intergenic
1172511667 20:35505044-35505066 CCCTGAGCTCAGCCAGACAGGGG - Intronic
1174123356 20:48283917-48283939 CTCTGACATCAGCCAGCCGAGGG + Intergenic
1175108075 20:56628595-56628617 CCCTGGCCTCAGCCAGCCGCGGG + Intergenic
1175895516 20:62334070-62334092 CCCTGACCACTGCCAGCCTGAGG + Intronic
1180999146 22:19979887-19979909 GCCGCACCTCAGCCCGCGGGTGG + Exonic
1181456537 22:23063193-23063215 CCCGGACCCAAGCCACCGGGAGG - Intronic
1181676300 22:24455597-24455619 CCCTGACATCAGCAGGCAGGTGG + Intergenic
1182309629 22:29395402-29395424 GCCTGCCCTCAGCAAGCAGGTGG - Intronic
1182475433 22:30574289-30574311 CCCTGCCCACTGCCAGAGGGTGG - Intronic
1183429207 22:37755578-37755600 CCATGACCTCAGGCATCCGGCGG + Exonic
1184240608 22:43209636-43209658 CCCAAACCTCAGCGGGCGGGAGG + Intronic
1184442562 22:44526771-44526793 CACAGACCTCAGACAGCGGCAGG + Intergenic
1184711101 22:46250033-46250055 CCCTGACCTCGGGCAGCGCTGGG - Intronic
1185074433 22:48675735-48675757 CTCAGGCCTCAGCCAGCAGGCGG - Intronic
1185413992 22:50699891-50699913 CCCTGTTCTCAGCCCGCGGAGGG + Intergenic
950006788 3:9696698-9696720 CCTTGACATCAGCCAGCTGGGGG + Intronic
951798214 3:26566319-26566341 CCCTGAGCTCAGCCAGAGGAGGG - Intergenic
953027360 3:39152951-39152973 CCCTGACCCCCGCCGGCCGGGGG + Intronic
954197226 3:49003978-49004000 CCCTGACCTCAGGCACTGAGGGG - Intronic
954654195 3:52184030-52184052 CCCTGAGCTCAGGCAGGGTGGGG - Intergenic
954708706 3:52494558-52494580 CCCTGGTCTCAGCCTGCAGGTGG - Intergenic
955238350 3:57159643-57159665 TCCTGCCCTCAGTCAGCCGGGGG - Intronic
955242323 3:57189206-57189228 TCCTGACCTCAGCCTGCCTGAGG - Intergenic
956522418 3:70120548-70120570 CTCTCACCTCTGCCAGCAGGAGG + Intergenic
959056988 3:101576779-101576801 CACTGACCTCACCAAGAGGGCGG - Intronic
961208882 3:125110006-125110028 CCCTAACCTAAGCCAGCCAGAGG + Intronic
967904285 3:194487525-194487547 CCCTGTCCTCCGCCTGCGGCCGG - Intronic
969608340 4:8213265-8213287 CCCAGCCCTCAGCCATGGGGAGG - Intronic
969719062 4:8883088-8883110 CCCAGACCTCAGGCAGAGAGTGG + Intergenic
969719077 4:8883148-8883170 CCCAGACCTCAGGCAGAGAGTGG + Intergenic
969719093 4:8883204-8883226 CCCAGACCTCAGGCAGAGAGTGG + Intergenic
969719100 4:8883232-8883254 CCCAGACCTCAGACAGAGAGTGG + Intergenic
970673464 4:18421704-18421726 GCCTGCCCTCAGCCACCTGGAGG + Intergenic
976658071 4:87510487-87510509 CCCAGAACTCAGCCAGCAGAGGG + Intronic
977708089 4:100093679-100093701 CTCTGACGTCAGCCAGCCAGGGG + Intergenic
979694745 4:123600220-123600242 CCTGGAGCTCAGCCAGCGTGTGG + Intergenic
981616931 4:146652253-146652275 ACTTGCCATCAGCCAGCGGGGGG - Intergenic
985966165 5:3340209-3340231 CCCTGACCTCAGAGACCAGGAGG - Intergenic
988359137 5:30212646-30212668 CCATGACAGCAGCCAGAGGGGGG + Intergenic
990087439 5:51995974-51995996 CCATGTCCTCAGCCAGCCCGAGG - Intergenic
990895858 5:60699841-60699863 CCCAGAGCTCAGCCGGCCGGGGG - Intronic
992078605 5:73214222-73214244 CCCTGAGCCCAGCCAGAGGCAGG + Intergenic
996404057 5:123089675-123089697 CCCCGCCCTCAGCCAGCGCCCGG - Intronic
997295340 5:132765374-132765396 GCCTGGCCTCAGACAGAGGGTGG - Intronic
997475263 5:134138993-134139015 CCCTGACCTCAGGCAGCATGGGG + Exonic
997594231 5:135095563-135095585 CTCTGACCCCAGCCAGCTGAAGG + Intronic
999306929 5:150525564-150525586 CCCTGTCCTGAGCCAGCCTGGGG - Intronic
999438936 5:151586319-151586341 CCCTGCCCCCAGCCAGCGGAAGG + Intergenic
999762571 5:154713834-154713856 CCCTAGCCTCAGCCAGCTAGAGG - Intronic
1000003949 5:157165907-157165929 CCATGACGTCAGGCAGTGGGAGG + Exonic
1001396200 5:171420752-171420774 CCCTGCCCGCAGCCAGCGAGGGG + Intronic
1001469802 5:172003680-172003702 CCCAGGCCTCAGGCAGCGGTAGG + Intronic
1002139670 5:177131589-177131611 CCCTGCCTTCAGCCAGCGACTGG - Intergenic
1002616225 5:180458147-180458169 CCCTGTCTTCAGCCAGGGGAAGG - Intergenic
1003590314 6:7431810-7431832 CCCTGGCCTAAGCCAGGGGGAGG + Intergenic
1004671824 6:17804363-17804385 CCCTATCATCAGCCAGCAGGGGG - Exonic
1006414639 6:33896207-33896229 CCCTGGCCTCATCCTGTGGGTGG + Intergenic
1011983441 6:93416453-93416475 CCCTCAGCTCAGCCTGGGGGTGG + Intronic
1012769064 6:103405442-103405464 CTCAGACCTCAGCCAGCAGAGGG - Intergenic
1013375544 6:109510237-109510259 CCCTGGGCTCAGCCAGAGCGTGG + Intronic
1016952541 6:149594231-149594253 CACTGACCTCACCAAGAGGGCGG + Intergenic
1017997020 6:159541025-159541047 CCATGACCCCAGCCAATGGGAGG + Intergenic
1018816598 6:167337117-167337139 TGCTGACCACAGCCAGCGGTTGG - Intronic
1018915470 6:168130042-168130064 CCCTGCCCGCAGCCTGCTGGTGG - Intergenic
1018942730 6:168319862-168319884 CCCTGCCCGCAGCCGGCGAGGGG - Intergenic
1019154682 6:170031114-170031136 CCCTGCCCTCAGGCTGCAGGGGG - Intergenic
1019498235 7:1351306-1351328 CCCTGAGGTCAGCAAGTGGGCGG - Intergenic
1019563119 7:1667643-1667665 CCCAGCCCTCAGGCAGCGTGGGG + Intergenic
1019577339 7:1743845-1743867 CCCTGGCCGCAGCCAGCCGGCGG + Intronic
1019947036 7:4338099-4338121 TCCTGACCTCAGGCTGGGGGTGG + Intergenic
1020014054 7:4820792-4820814 CCCAGTCCTCAGCCTCCGGGCGG - Intronic
1020059848 7:5144002-5144024 CCCTGATCACAGCCAGTGGTGGG - Intergenic
1022650206 7:32267226-32267248 CCCTAACCTCAGCCTGCCAGGGG - Intronic
1023790423 7:43749590-43749612 CCCTGGGCTCAGCCAGAGGAGGG - Intergenic
1024009889 7:45258692-45258714 CCCTGACCTCAGCCTCCCTGAGG - Intergenic
1025032425 7:55568910-55568932 ACCTCACTTCAGCCAGCTGGCGG + Intronic
1029104729 7:98165893-98165915 CCCTGACCAGAGCCAGCAGAGGG + Intronic
1029449253 7:100631799-100631821 CCCTCACCTCAGCAGGCGGGAGG + Exonic
1029650326 7:101886933-101886955 CCCAGACCTCAGCCACAGGATGG + Intronic
1030385481 7:108863295-108863317 CCCTGCCCTCTGCCAGTGGAGGG + Intergenic
1031011191 7:116526250-116526272 CCCTGACCCCTGGCGGCGGGCGG + Intronic
1032097790 7:128948060-128948082 CCCCAACCCCATCCAGCGGGAGG + Exonic
1035003705 7:155638935-155638957 CTCTAACCTCACACAGCGGGAGG + Intronic
1036659317 8:10697807-10697829 CCATGCCCTCGGCCAGCGGGAGG - Exonic
1037547837 8:19940467-19940489 CCTGGACCCCAGCGAGCGGGCGG - Intronic
1038376985 8:27049507-27049529 CACAGACTTCAGCCAGAGGGGGG + Intergenic
1039463263 8:37763198-37763220 CCCTCACCTCGGCCTCCGGGCGG - Intronic
1039759971 8:40563956-40563978 CCCTTTCCTCAGCCACTGGGTGG - Intronic
1039968149 8:42298843-42298865 CTCTGACATCCGCCAGCTGGTGG + Intronic
1042497638 8:69472598-69472620 ACCTGCCCTCAGCCAGGGAGAGG + Intronic
1045304809 8:100950608-100950630 CCCCGACCGGAGCCAGAGGGAGG + Intronic
1049593535 8:143473211-143473233 CCCTGTGCACAGCCAGCAGGGGG - Intronic
1049769850 8:144374711-144374733 CCCTGCCCTGAGGCGGCGGGCGG + Intronic
1049831583 8:144704564-144704586 CCCTGGCCTCAGGCAGGGGTGGG + Intergenic
1050555312 9:6784642-6784664 CCCTGGCCTCAGCAGGCAGGTGG + Intronic
1051370647 9:16356161-16356183 CCCAGAGCTCAGCCTGCTGGTGG + Intergenic
1055468838 9:76591736-76591758 CCCTGACCACAGACAGTGGGGGG + Intergenic
1058686790 9:107487610-107487632 CCCTGACGGCAGCCACCCGGTGG - Exonic
1059780328 9:117519301-117519323 CCTTGACCTCATCCAGCTGAAGG + Intergenic
1060942647 9:127551934-127551956 CCATGAGCTCAGCCAGCAGCAGG + Intronic
1060983612 9:127807537-127807559 CCCTGCCCTGAGCCACCAGGCGG - Intronic
1061444805 9:130631795-130631817 CACTGACCTCAGCGATGGGGTGG + Intronic
1062023549 9:134330193-134330215 CCCAGCCCTGAGCCAGCTGGGGG - Intronic
1062401673 9:136375496-136375518 GCCTGACCCCAGCCAGGTGGGGG + Intergenic
1186907791 X:14130629-14130651 CCCTCACCTCAGTCAGCGATGGG + Intergenic
1189361710 X:40358719-40358741 TCCTGACCTAGGCCAGCGGGAGG - Intergenic
1190265892 X:48827015-48827037 CCGGGGCCTCAGCCCGCGGGAGG - Intergenic
1192611290 X:72569966-72569988 CCCTGACCTGGGCCACAGGGAGG + Intronic
1198699464 X:139382134-139382156 CCCTGAACTCAGCCAGAGCAGGG - Intergenic
1198750137 X:139931509-139931531 CCTAGGGCTCAGCCAGCGGGCGG - Intronic
1199853904 X:151744351-151744373 CCGTGTACTCAGCCAGCAGGCGG - Exonic
1200146742 X:153930297-153930319 CCCTCTCCTCAGCCAGCGACAGG - Intronic
1201577788 Y:15478853-15478875 CCCTCACCTTCACCAGCGGGAGG - Intergenic
1202279961 Y:23172920-23172942 CCTAGTCCTCAGCCAGCAGGTGG + Intronic
1202280690 Y:23183765-23183787 CCTAGTCCTCAGCCAGCAGGTGG + Intronic
1202281419 Y:23194613-23194635 CCTAGTCCTCAGCCAGCAGGTGG + Intronic
1202284472 Y:23223906-23223928 CCTAGTCCTCAGCCAGCAGGTGG - Intronic
1202433091 Y:24808998-24809020 CCTAGTCCTCAGCCAGCAGGTGG + Intronic
1202436146 Y:24838292-24838314 CCTAGTCCTCAGCCAGCAGGTGG - Intronic
1202436874 Y:24849142-24849164 CCTAGTCCTCAGCCAGCAGGTGG - Intronic