ID: 1141694674

View in Genome Browser
Species Human (GRCh38)
Location 16:85613842-85613864
Sequence CCCCCACACCCCCGCTTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141694674_1141694686 8 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694686 16:85613873-85613895 GCTCGCTACTGGGGCCGCGCCGG No data
1141694674_1141694685 -1 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694685 16:85613864-85613886 GGGGGGGGTGCTCGCTACTGGGG No data
1141694674_1141694683 -3 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694683 16:85613862-85613884 GGGGGGGGGGTGCTCGCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 119
1141694674_1141694684 -2 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694684 16:85613863-85613885 GGGGGGGGGTGCTCGCTACTGGG 0: 1
1: 0
2: 0
3: 7
4: 91
1141694674_1141694688 14 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694688 16:85613879-85613901 TACTGGGGCCGCGCCGGTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 11
1141694674_1141694687 13 Left 1141694674 16:85613842-85613864 CCGAGGAAGCGGGGGTGTGGGGG No data
Right 1141694687 16:85613878-85613900 CTACTGGGGCCGCGCCGGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141694674 Original CRISPR CCCCCACACCCCCGCTTCCT CGG (reversed) Intronic
No off target data available for this crispr