ID: 1141695852

View in Genome Browser
Species Human (GRCh38)
Location 16:85619086-85619108
Sequence GTCACCACAGCAGACCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141695844_1141695852 26 Left 1141695844 16:85619037-85619059 CCCCTTTTCCCAAAAAGACTGGA 0: 1
1: 0
2: 1
3: 29
4: 251
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233
1141695845_1141695852 25 Left 1141695845 16:85619038-85619060 CCCTTTTCCCAAAAAGACTGGAG 0: 1
1: 0
2: 0
3: 20
4: 338
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233
1141695850_1141695852 -10 Left 1141695850 16:85619073-85619095 CCCTAAGGCTCAAGTCACCACAG 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233
1141695846_1141695852 24 Left 1141695846 16:85619039-85619061 CCTTTTCCCAAAAAGACTGGAGT 0: 1
1: 0
2: 0
3: 19
4: 251
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233
1141695848_1141695852 17 Left 1141695848 16:85619046-85619068 CCAAAAAGACTGGAGTTGCTTTT 0: 1
1: 0
2: 3
3: 16
4: 237
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233
1141695847_1141695852 18 Left 1141695847 16:85619045-85619067 CCCAAAAAGACTGGAGTTGCTTT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG 0: 1
1: 0
2: 3
3: 33
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141695852 Original CRISPR GTCACCACAGCAGACCCTGC CGG Intronic
900439546 1:2646823-2646845 GACACCACAGCAGATCCTGAGGG - Intronic
900781963 1:4624272-4624294 GTCACCAAAGCAGGGCCTGTCGG - Intergenic
902233462 1:15043009-15043031 GTCCCCAGAGCAGAGCCAGCAGG - Intronic
902632777 1:17715512-17715534 GATACCACAGCAGATTCTGCAGG - Intergenic
902928751 1:19715779-19715801 GTCACCACAGCACCACCTGGTGG - Intronic
904749036 1:32729441-32729463 GTCTGCACAGCTGCCCCTGCTGG - Intergenic
905088664 1:35408449-35408471 GCCACCACACCTGGCCCTGCAGG - Intronic
905166434 1:36085844-36085866 GTCAGCAGAGCAAAACCTGCAGG + Exonic
906608192 1:47185362-47185384 GCCTCCACAGCAGGCCCTGCAGG + Intronic
906661708 1:47587567-47587589 GTCACCATAGAAGCCCCTCCAGG - Intergenic
907371301 1:54005246-54005268 GCCACAGCAGCAGACCCTGCGGG + Intergenic
912712735 1:111961277-111961299 GTCACCCCATCAGACCCGGCTGG + Intronic
912933619 1:113984627-113984649 TCCACCACAGCAGCCCCTCCTGG - Intergenic
913090157 1:115471400-115471422 GTCTCCACCCCAGTCCCTGCTGG + Intergenic
913325096 1:117621220-117621242 GTGATCACAGCAGGCTCTGCAGG - Intronic
914402582 1:147337164-147337186 GTCACCATAGCAACCACTGCCGG - Intergenic
914993116 1:152515508-152515530 GTCGCCGCAGCAGCCCCTGCCGG - Exonic
915469732 1:156118641-156118663 CTGAGCACAGCAGACCCAGCAGG - Intronic
917353382 1:174101708-174101730 GCCACCACACCCGACCCTACAGG + Intergenic
918612973 1:186513097-186513119 CTCCCCACAGCAGATCCTGAAGG - Intergenic
918717877 1:187815152-187815174 GTCACCACTCCAGAGCCTGCCGG - Intergenic
920053210 1:203175664-203175686 GTGCCCACAGCAGAGCCTCCCGG - Exonic
921797863 1:219368612-219368634 GACACCACAGCAGACACTGTTGG - Intergenic
924708233 1:246515085-246515107 GTCACCACTCCAGCCCCTCCTGG + Intergenic
1062828461 10:588649-588671 GTCAGCACAGCAGCCCCTCTTGG - Intronic
1065135872 10:22669573-22669595 GTCAAGACAGCAAACCCTGTAGG + Intronic
1067045938 10:42985237-42985259 CTCACCACCACTGACCCTGCTGG - Intergenic
1071472584 10:85994273-85994295 ATCCTCACAGCAGACCCGGCAGG - Intronic
1074709264 10:116163598-116163620 GTGACCACAGCACAGCCCGCGGG - Intronic
1076280858 10:129244582-129244604 GTGACCACAGCATCCGCTGCTGG - Intergenic
1077374207 11:2198059-2198081 GGCACCACAGCCCAGCCTGCAGG + Intergenic
1077456869 11:2686555-2686577 GTCACCACAGCTGTCCTTGCAGG - Intronic
1078102567 11:8338463-8338485 TTCACCCCACCAGACCCAGCCGG + Intergenic
1078929695 11:15903633-15903655 GGCAGCTCAGCAGACCCTGAGGG + Intergenic
1079249245 11:18775067-18775089 GTCCTCACAGCAGCCCCTGGAGG + Intronic
1083318703 11:61832156-61832178 GTCACCAATGCAGACCGGGCAGG - Intronic
1083805912 11:65073853-65073875 TTCCCCACACCAGACACTGCTGG + Intronic
1083909363 11:65696993-65697015 GTCACCTGAGCTGACCATGCTGG - Intergenic
1084073546 11:66754115-66754137 GAGACCACAGCAGAGACTGCTGG - Intronic
1084788240 11:71456528-71456550 GTCACCACTGCAGCTCCTCCAGG - Intronic
1086332008 11:85763515-85763537 CTCCTCACAGCAGAGCCTGCTGG - Intronic
1088117536 11:106329465-106329487 GATCCAACAGCAGACCCTGCTGG - Intergenic
1088350230 11:108878688-108878710 TTCACCACAGCAGTTCATGCTGG - Intronic
1089678322 11:120105431-120105453 GTCAACACTGCACACCCTGATGG - Intergenic
1090522399 11:127493334-127493356 TTCACCACACCAGATCCTACTGG + Intergenic
1091253298 11:134162186-134162208 ATCTCCACAGAAGACCCTGAGGG + Intronic
1091782698 12:3223980-3224002 GGCTGCACAGGAGACCCTGCTGG - Intronic
1094837681 12:34329766-34329788 GCCATCCCAGCAGACCCTGCAGG - Intergenic
1102219960 12:111187661-111187683 GGCACCTCAGGAGACCCAGCCGG - Intronic
1104258982 12:127165738-127165760 CTGACCACAGCAGACCATGATGG - Intergenic
1104418948 12:128619438-128619460 CTCCCCAGAGCAGACCCTGCAGG + Intronic
1104527982 12:129542083-129542105 ATCACCTCAGCAGAGCCAGCAGG + Intronic
1104970010 12:132526972-132526994 GGGACCTCAGCAGCCCCTGCAGG + Intronic
1105250925 13:18697996-18698018 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1105422395 13:20264637-20264659 ATCAGCAGAGGAGACCCTGCTGG + Intergenic
1105578965 13:21675876-21675898 GTCACCTCTGCAGCTCCTGCTGG - Intronic
1105725480 13:23159374-23159396 TTCACCACAGCAAACCCTTCGGG + Intergenic
1105832086 13:24171595-24171617 GTCAGCACAGCTGACCCAGTGGG - Intronic
1106901702 13:34360573-34360595 GCCACCACACCAGGCCCTGAGGG + Intergenic
1108497490 13:51039981-51040003 GCCACCAAAGCAGAGCCTCCTGG + Intergenic
1108752598 13:53463670-53463692 GACACCTCAGCAAAGCCTGCAGG + Intergenic
1109267171 13:60215246-60215268 ATCACCACAGCAGAATCTGTAGG - Intergenic
1112532835 13:100221659-100221681 GACGCCACAGCTGAACCTGCAGG + Intronic
1113913227 13:113854543-113854565 TGCACCACAGGACACCCTGCTGG - Intronic
1114628405 14:24144247-24144269 GTCACCACAGGAGAAGGTGCTGG - Exonic
1116814881 14:49574742-49574764 GTCAGCTCACCAGACCCAGCAGG - Exonic
1118976212 14:70678933-70678955 GAAATCACAGAAGACCCTGCAGG + Intergenic
1119765267 14:77183765-77183787 GTCACCCCAGCAGCTCCTGGTGG - Intronic
1120919437 14:89741464-89741486 GGCACCACTGCACTCCCTGCTGG + Intergenic
1121900841 14:97692190-97692212 GTCTTCACAGCAAACCCTGAGGG - Intergenic
1122486464 14:102085548-102085570 GCCACCACAGCAGAACCTTTTGG + Intronic
1122864169 14:104596064-104596086 CTCAGCACAGGAGGCCCTGCAGG + Intronic
1123009280 14:105339542-105339564 GCCACCACACCTGGCCCTGCTGG - Intronic
1202904580 14_GL000194v1_random:60790-60812 GTGACCACAATAGGCCCTGCAGG + Intergenic
1124408148 15:29410386-29410408 TCCACCAGAGCAGCCCCTGCAGG - Intronic
1124475171 15:30026843-30026865 GCCACCACAGTAGGTCCTGCGGG - Intergenic
1127801764 15:62483299-62483321 GTCAGCAGAGCTCACCCTGCAGG - Intronic
1129408495 15:75336027-75336049 GTCGACTCAGCTGACCCTGCGGG + Exonic
1129476907 15:75791813-75791835 GCCACCCCACCAGGCCCTGCTGG + Intergenic
1130652556 15:85770370-85770392 GCGTCCACAGCAAACCCTGCAGG - Intronic
1131128037 15:89872696-89872718 GTCTCCCCAGCAGCCGCTGCAGG - Intronic
1132175591 15:99711542-99711564 GACAACATAGCAGACCCAGCTGG + Intronic
1132240950 15:100256695-100256717 GACACCATAGCAGACACAGCTGG - Intronic
1132615020 16:836102-836124 CTCACCACTGCAAACCCTGCAGG - Intergenic
1132907151 16:2288512-2288534 GTCACCTGTGCAGACTCTGCAGG + Intronic
1134818383 16:17225452-17225474 GTCCACCAAGCAGACCCTGCTGG + Intronic
1136102125 16:28004038-28004060 GTCAGCCCAGCAGCCCCAGCAGG - Intronic
1136297938 16:29314261-29314283 GTCTCCAAAGCAGAGCCAGCCGG - Intergenic
1137543019 16:49377685-49377707 GTCCCCACAGCAGTGGCTGCAGG + Intronic
1141638578 16:85328658-85328680 TGCCCCACTGCAGACCCTGCAGG - Intergenic
1141695852 16:85619086-85619108 GTCACCACAGCAGACCCTGCCGG + Intronic
1142006646 16:87692466-87692488 GACAGCACCCCAGACCCTGCTGG - Intronic
1143068672 17:4270592-4270614 GTCAGCACTGCACACCCTCCAGG - Exonic
1144672777 17:17142371-17142393 GTCAGCACCACAGAGCCTGCAGG + Intronic
1144721923 17:17476961-17476983 GTCACCACCGCGCGCCCTGCAGG - Intergenic
1147581905 17:41631813-41631835 GACACCCTAGTAGACCCTGCAGG + Intergenic
1149605941 17:57925386-57925408 GTGACCACAGCAGAGCCCGAGGG - Intronic
1149637600 17:58183363-58183385 GTCCCCAGAGCAGACTCTCCTGG - Intergenic
1151966278 17:77433406-77433428 GACACCTAAGCAGACCCTGTTGG - Intronic
1152532567 17:80927916-80927938 GTCCACACAGCAGGACCTGCTGG - Intronic
1152558276 17:81065420-81065442 GTCTCCACACCAGCCCCTGGTGG - Intronic
1152869337 17:82743583-82743605 AGCACCACAGCCGACCCAGCTGG - Intronic
1153551084 18:6262374-6262396 CTCAACACAGCAGGCACTGCCGG + Intronic
1153627765 18:7038213-7038235 GTGTCCACAGCAGTCACTGCTGG + Intronic
1154437920 18:14360918-14360940 GCCCCCACGGCAGCCCCTGCAGG + Intergenic
1155961434 18:31998808-31998830 TGGACCACAGCAGACTCTGCAGG - Intergenic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1160130551 18:76221567-76221589 GTGCACACAGCAGACCCTGCCGG - Intergenic
1160566703 18:79790489-79790511 GCCAGCACAGCAGCCCCTACAGG - Intergenic
1160874667 19:1291471-1291493 GTCACCCCAGCAGGTCTTGCTGG + Intronic
1160990596 19:1858860-1858882 GCCCCCACAGCTCACCCTGCTGG + Intronic
1161057968 19:2200145-2200167 GTCGGCCCTGCAGACCCTGCTGG + Intronic
1161237760 19:3206252-3206274 GTCCCTACAGCAGATCCAGCAGG + Exonic
1161456306 19:4371346-4371368 GCCACCACAGCTGTGCCTGCCGG - Intronic
1162329498 19:10018903-10018925 GTCCCCACAGCTCACCCTGCAGG - Exonic
1163678362 19:18666705-18666727 GTCACCCCAGCACAGCCTCCTGG + Intronic
1163686309 19:18713865-18713887 CTCACCCCAGCAGATACTGCAGG - Intronic
1163862634 19:19750182-19750204 GCCACAACACCAGGCCCTGCTGG + Intergenic
1164560837 19:29291057-29291079 ATCCCCACAGCATCCCCTGCTGG + Intergenic
1164589461 19:29498388-29498410 GTCAGAACAGCAGGTCCTGCGGG + Intergenic
1165954741 19:39495275-39495297 GTCACCATAGAAGGCCATGCTGG - Intergenic
1168070243 19:53945676-53945698 GTCACCACAGCCCATCCTGCAGG - Intergenic
1168136782 19:54357104-54357126 ATCATCACAGAAGACTCTGCTGG - Intronic
1168351821 19:55680415-55680437 ATCCCCACAGCAGAGCCTGTAGG + Intronic
925082813 2:1082991-1083013 GACACAGCAGCAGCCCCTGCAGG + Intronic
925412600 2:3648536-3648558 GGCAGCACCCCAGACCCTGCAGG - Intergenic
927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG + Intergenic
930832650 2:55761706-55761728 CTAACCACAGCATACCCTACAGG - Intergenic
931188474 2:59976612-59976634 TTCACCACATCAGATCCTGTGGG + Intergenic
931894856 2:66717362-66717384 ATCACCACAGCAGAACCTTGGGG + Intergenic
932420611 2:71599244-71599266 GTCACCACAGGAGGTCCTGTGGG - Intronic
934720441 2:96571578-96571600 ATCACCATGGCAGACCATGCAGG + Intergenic
934932566 2:98439880-98439902 GTAACAACAGCAAACCCTGGGGG - Intergenic
935358020 2:102222707-102222729 TTCACCCAAGCAGAGCCTGCTGG + Intronic
937150387 2:119682164-119682186 GTCACCACTGCAGTCCATCCCGG - Intronic
937465410 2:122128258-122128280 GTCAACACACCAAAACCTGCAGG - Intergenic
937905696 2:127051785-127051807 GGCACCACGGCAGGCCCTGCAGG + Intronic
942041087 2:172063565-172063587 GCCAGCACAACAGACCCTCCAGG - Intronic
942421003 2:175807719-175807741 GTGTCCACCGCAGACCCTGCTGG + Intergenic
942798297 2:179847244-179847266 GTCCCCACACTATACCCTGCAGG + Intronic
944706523 2:202294676-202294698 GCCACCACACCCGGCCCTGCTGG - Intronic
945060419 2:205903930-205903952 ATCACCACAGCACACCCTGCTGG - Intergenic
948386564 2:237584360-237584382 GCCACCCTAGCAGAGCCTGCAGG - Intronic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
1168772008 20:421410-421432 CTCACCACAGCGGACCCTTGTGG + Intronic
1170131610 20:13026700-13026722 ATGACCATAGCAGACCCTGCTGG + Intronic
1172804004 20:37598338-37598360 GTCCTCACACCAGGCCCTGCAGG - Intergenic
1174547545 20:51337048-51337070 GGCCCCACAGCAGGCCCTTCAGG + Intergenic
1176052888 20:63129957-63129979 GACACCACAGCAGCACCTGGAGG - Intergenic
1176093334 20:63328587-63328609 GTCAGCACAGCAGCTCCTGCTGG + Intronic
1176457751 21:6928551-6928573 GTCCCCACGCCAGCCCCTGCAGG - Intergenic
1176623950 21:9075557-9075579 GTGACCACAATAGGCCCTGCAGG + Intergenic
1176835922 21:13793635-13793657 GTCCCCACGGCAGCCCCTGCAGG - Intergenic
1179194809 21:39155178-39155200 GTCACCACTGCAAACGCTGTGGG - Intergenic
1179996627 21:44977296-44977318 GCCCCCACGGCAGCCCCTGCAGG - Intergenic
1180678608 22:17607022-17607044 GACAACACAGAAGTCCCTGCTGG - Intronic
1180971795 22:19819802-19819824 GAAACCACAGGAGACACTGCAGG + Intronic
1181672648 22:24432933-24432955 ATGACCACAGCAGACCAGGCAGG + Intronic
1182045518 22:27271048-27271070 GTCACCCCAGCAGACAGCGCTGG + Intergenic
1183246327 22:36696428-36696450 GCCACCACAGCTCACCATGCAGG + Intronic
1183417780 22:37692408-37692430 CCCACCAGAGTAGACCCTGCGGG + Exonic
1184348401 22:43926927-43926949 GTCCCCAGAGCAGACTCTGCAGG + Exonic
1184707533 22:46224742-46224764 TTCACCCCAGCAGCCCCTGCAGG - Intronic
1184969034 22:48002162-48002184 CTGCCCACAGCAGACCCTGAAGG - Intergenic
1185326558 22:50228495-50228517 GCCACAGCAGCAGGCCCTGCAGG + Intronic
949968701 3:9383189-9383211 GTCCCCACAGCAAACCCTCCTGG + Exonic
953388496 3:42520817-42520839 GTCACAACAGCAGGCACTGGGGG - Intronic
953968404 3:47327994-47328016 GTGACAGCAGCAGACCCTGGGGG - Intronic
954092238 3:48294480-48294502 CTCACCACAGCACATCCTCCAGG - Exonic
954293668 3:49662647-49662669 GGCGCCAGACCAGACCCTGCTGG - Intronic
954364066 3:50137136-50137158 GCCACCCCAGCAGGCCCTGGGGG - Intergenic
960995374 3:123336786-123336808 TTCTCCACAGATGACCCTGCTGG + Intronic
961634042 3:128321740-128321762 GCCACCAGTGCAGACCCAGCAGG - Intronic
961733787 3:128987456-128987478 GTCACCACAGCATGGCCTGGTGG + Intronic
962082780 3:132158160-132158182 GGGACAGCAGCAGACCCTGCAGG - Intronic
962844774 3:139264552-139264574 GTCAGACCAGCAGACCATGCTGG + Intronic
968088236 3:195884084-195884106 GTCACCACAGCATACAGTTCTGG - Intronic
968485229 4:857623-857645 GGCACCACTGCAGACCCCGCAGG - Intronic
968887029 4:3340568-3340590 GTCACCACAGAAGAGCACGCTGG + Intronic
969517124 4:7654036-7654058 TTCACCACAGCAGATCCCCCAGG - Intronic
969517624 4:7656435-7656457 ATCCCCACAGCAGCCCATGCGGG + Intronic
969652170 4:8474307-8474329 GTCCCCACAGCAGCACCTCCTGG - Intronic
970510441 4:16776813-16776835 ATAACCACAGAAGGCCCTGCAGG + Intronic
970610981 4:17725047-17725069 CTCACCGCTGCAGAGCCTGCTGG + Intronic
972213119 4:36862394-36862416 GCCACCACCGCAGACACAGCTGG - Intergenic
979057815 4:116017370-116017392 GTTACCACCGCATAACCTGCCGG - Intergenic
980367093 4:131818573-131818595 TTCACCACTGCAGACACAGCTGG - Intergenic
980968490 4:139546770-139546792 GTCACCAAAGCAGTGCCTACAGG + Intronic
982503844 4:156193969-156193991 GCCACCAGAGCAGACTGTGCAGG - Intergenic
984531368 4:180920561-180920583 GTCACCACATCAAACCCTGGAGG - Intergenic
985475515 5:76776-76798 GTCTCCTCAGCAGAGCCTGCTGG + Intergenic
990031469 5:51264305-51264327 GGGACCACAGAAGACCCTGAAGG - Intergenic
991496657 5:67233370-67233392 TTCACCAGAGCAGGCTCTGCGGG - Intergenic
992250825 5:74874441-74874463 GGGACCACAGAAGATCCTGCAGG + Intergenic
994496385 5:100518145-100518167 CTCACCACTGCAGACACAGCTGG + Intergenic
995172423 5:109132475-109132497 ATCCTCACAGCAGAACCTGCTGG - Intronic
997580707 5:135015025-135015047 GACAACACAGCAGACCCATCTGG - Intergenic
997646244 5:135483914-135483936 GTGATCAGAGCTGACCCTGCTGG + Intergenic
997646523 5:135485856-135485878 GTGATCAGAGCAGACCCTGCTGG + Intergenic
997852556 5:137345889-137345911 GGCACTCCAGCAGACACTGCAGG + Intronic
998959536 5:147470137-147470159 GACACCTCAGCTGACCCTGAAGG - Intronic
1001845247 5:174916397-174916419 AGCACCACAGCCGCCCCTGCTGG - Intergenic
1002065681 5:176650595-176650617 TTCACATCAGCAGACCCAGCAGG + Intronic
1003074465 6:2971324-2971346 GTGACCCCAGCAGTCCCAGCGGG - Intronic
1003495153 6:6657307-6657329 GTAACCACAGCAGACCAATCTGG + Intergenic
1003939385 6:11009223-11009245 GGGACCACAGCAGACCCCTCTGG + Intronic
1007251779 6:40500179-40500201 GTCAGCACAGCAGAGCCTCCCGG - Intronic
1007664767 6:43507669-43507691 TTCCCCACTTCAGACCCTGCTGG - Exonic
1008509374 6:52261928-52261950 GTCACCACTGCAATCTCTGCAGG + Intergenic
1011010019 6:82693324-82693346 GTTGCCAAAGTAGACCCTGCTGG - Intergenic
1013010735 6:106117837-106117859 CTCACCACTGGAGACCCTGGTGG + Intergenic
1013667894 6:112366815-112366837 GCCACCACAGCAGCAGCTGCAGG + Intergenic
1018057500 6:160065073-160065095 GTCACCACAGCAGCTCCAGGTGG - Intronic
1018176186 6:161181303-161181325 GGCACCACAACAGAACCTGCAGG - Intronic
1018682592 6:166276215-166276237 GGCACTGCAGCAGATCCTGCTGG - Intergenic
1019176771 6:170163427-170163449 GTCACCACAGCGGAGCCTGTAGG + Intergenic
1019214817 6:170436440-170436462 GTCATCATAACAGACCCTACAGG - Intergenic
1019490698 7:1311881-1311903 GCCACAACAGCAGGCCCTGGAGG - Intergenic
1019597948 7:1867034-1867056 GTCACCACAGCAGCACCTGCTGG + Intronic
1019902602 7:4034295-4034317 GTCACCACAGAAGACGTTGTGGG + Intronic
1020062222 7:5161027-5161049 TTAACCACAGCTGAACCTGCTGG + Intergenic
1020165923 7:5807650-5807672 TTAACCACAGCTGAACCTGCTGG - Intergenic
1020446095 7:8269407-8269429 GTCACCACCACAGACCCTCATGG - Intergenic
1022497431 7:30861856-30861878 GTCACCACAGAAGCCCCATCAGG - Intronic
1023268712 7:38436291-38436313 GTCACTCCAGCAGAACCTGCAGG + Exonic
1024943315 7:54784271-54784293 GTCAGCATAGCAGACCTTGAAGG - Intergenic
1025014736 7:55430087-55430109 GGCCCTACAGCAGGCCCTGCGGG - Intronic
1031965685 7:128026717-128026739 GCCACCTCAGCAGAAGCTGCTGG - Intronic
1032736210 7:134694802-134694824 GTCATCAGAGCAGTCCCTGGTGG + Intergenic
1033225962 7:139562665-139562687 CTCACCACGGCAGAGCCAGCAGG - Exonic
1033889919 7:145999410-145999432 GGCATCACAGCAGACCCATCTGG - Intergenic
1034189379 7:149201990-149202012 GGCACCTCAGCAGACCCTGATGG - Intronic
1035382715 7:158450033-158450055 ATCACCAGAGCAGACTGTGCTGG - Intronic
1035636206 8:1146161-1146183 CTCTCCACAGGAGCCCCTGCAGG + Intergenic
1037822332 8:22141008-22141030 GTCACCAGACCTGACACTGCTGG + Intronic
1041206217 8:55500540-55500562 CTCACCACAGGAGACCCTTATGG + Intronic
1041256517 8:55983650-55983672 CTGACAATAGCAGACCCTGCTGG - Intronic
1042809676 8:72810408-72810430 TCCACCACAGCAGAGCCTGCAGG - Intronic
1042867113 8:73365844-73365866 GTGATCAAAGCAGACCCAGCAGG + Intergenic
1046013912 8:108583321-108583343 GACATCACAGCAGAAGCTGCTGG + Intergenic
1049360681 8:142211288-142211310 GGGCCCACAACAGACCCTGCAGG - Intergenic
1049593714 8:143473992-143474014 GTAACCAGAGAAGGCCCTGCTGG + Intronic
1049686940 8:143942795-143942817 GTCCCCACCGCACATCCTGCTGG - Intronic
1049958306 9:713268-713290 GGCAGAACAGCAGACACTGCTGG + Exonic
1050567490 9:6901317-6901339 GTCACCTCAGCAGAACCTGCAGG - Intronic
1051893407 9:21965679-21965701 CACACCACAGCGGAGCCTGCTGG + Intronic
1052216346 9:25971247-25971269 GCTACCACATCAGACCATGCAGG + Intergenic
1053543288 9:38996825-38996847 GCCACCTCAGCAGAGCCTCCTGG + Intergenic
1053631438 9:39944288-39944310 TTCACCACTGCAGACACAGCTGG - Intergenic
1053774326 9:41519243-41519265 TTCACCACTGCAGACACAGCTGG + Intergenic
1053807723 9:41820333-41820355 GCCACCTCAGCAGAGCCTCCTGG + Intergenic
1054212449 9:62306410-62306432 TTCACCACTGCAGACACAGCTGG + Intergenic
1054312538 9:63542421-63542443 TTCACCACTGCAGACACAGCTGG - Intergenic
1054622869 9:67367094-67367116 GCCACCTCAGCAGAGCCTCCTGG - Intergenic
1055449152 9:76415341-76415363 GTCACCACACCTGACCTTGACGG + Intergenic
1057270815 9:93650455-93650477 GTCACAGCAGCCGCCCCTGCAGG - Intronic
1057814399 9:98284018-98284040 GCAGCCACAGCAGCCCCTGCAGG + Intergenic
1058070006 9:100592152-100592174 GCCACCACATCAGAGCATGCAGG - Intergenic
1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG + Exonic
1061509567 9:131052339-131052361 TCCTGCACAGCAGACCCTGCAGG - Intronic
1061959685 9:133981730-133981752 GTCCCCACTGCCGCCCCTGCGGG + Intronic
1062590404 9:137272065-137272087 GTCTCCACTGCAGACACAGCAGG - Exonic
1203747134 Un_GL000218v1:45985-46007 GTGACCACAATAGGCCCTGCAGG + Intergenic
1203562973 Un_KI270744v1:73495-73517 GTGACCACAATAGGCCCTGCAGG - Intergenic
1185757666 X:2664752-2664774 GTCACTAGAACAGACTCTGCAGG - Intergenic
1186564265 X:10645692-10645714 GTCACCACAGCAGTGGCTGGAGG - Intronic
1192123086 X:68475532-68475554 GTCAACACAGCAAACCCGGGAGG - Intergenic
1196457472 X:115900605-115900627 TGCACCTCAGCAGACCCTTCTGG + Intergenic
1200083874 X:153593303-153593325 GTGACCCCAGCACACCATGCAGG + Intronic
1201160454 Y:11160980-11161002 GTGACCACAATAGGCCCTGCAGG + Intergenic