ID: 1141698648

View in Genome Browser
Species Human (GRCh38)
Location 16:85632483-85632505
Sequence GCCTTTGGTGGCAAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141698641_1141698648 2 Left 1141698641 16:85632458-85632480 CCTGAATACATGGCCAGGACTCA 0: 1
1: 0
2: 3
3: 10
4: 125
Right 1141698648 16:85632483-85632505 GCCTTTGGTGGCAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 154
1141698640_1141698648 3 Left 1141698640 16:85632457-85632479 CCCTGAATACATGGCCAGGACTC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1141698648 16:85632483-85632505 GCCTTTGGTGGCAAGTTCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141698648 Original CRISPR GCCTTTGGTGGCAAGTTCTG GGG Intronic
900138275 1:1127980-1128002 GGCTTTGGTGGCCCGTGCTGTGG + Intergenic
900262252 1:1737884-1737906 GCCTGTGGTGGCGGGTGCTGGGG + Intronic
902471276 1:16648698-16648720 GCCTTTGGTGGTGAGGGCTGAGG - Intergenic
902487532 1:16758747-16758769 GCCTTTGGTGGTGAGGGCTGAGG + Intronic
902686186 1:18079227-18079249 CCCTTTGCTGGCAGATTCTGGGG - Intergenic
902751906 1:18521618-18521640 TTCTTTAGTGGCAATTTCTGAGG + Intergenic
903071041 1:20727138-20727160 GCCTTTGGTGGATGGTCCTGAGG - Intronic
905870912 1:41404216-41404238 GCCTTCAGTGGGAACTTCTGGGG + Intergenic
910432114 1:87169060-87169082 GCCTTTGCTCACAAGTTTTGCGG - Exonic
912668391 1:111603487-111603509 GCCATTGGTAGGATGTTCTGGGG + Intronic
912953600 1:114137239-114137261 GCTTCTGGTTGCATGTTCTGGGG - Intronic
915002920 1:152609838-152609860 TCCTCTGTTGGCAGGTTCTGCGG + Intergenic
916517500 1:165533183-165533205 GCTTTGGGTCTCAAGTTCTGCGG - Intergenic
918756650 1:188346000-188346022 GCTGTTGGTGGCAAGGTTTGTGG + Intergenic
919373695 1:196764111-196764133 GCCCTAGGTGGCAAGATTTGTGG + Intergenic
919380135 1:196848788-196848810 GCCCTAGGTGGCAAGATTTGTGG + Intronic
921289196 1:213639447-213639469 CCTTTTGGTGGCAAGGGCTGGGG + Intergenic
922004611 1:221517065-221517087 TACCTTGGTGGCAATTTCTGTGG + Intergenic
924155993 1:241177212-241177234 GCCTTCCTTGGCAAGCTCTGTGG - Intronic
1067162973 10:43842732-43842754 CCCAGTGGTGGCAAGGTCTGTGG - Intergenic
1072108364 10:92294603-92294625 GTTTTTGGTGGCAATTTTTGAGG + Intronic
1076519915 10:131075077-131075099 GTCTTTGGTGGCCAACTCTGGGG + Intergenic
1077200965 11:1307345-1307367 GCCTGTGCTGGCAAGTGCTGAGG - Intronic
1077329563 11:1978037-1978059 GCCTCTGGAGGCAAGATGTGGGG + Intronic
1088569841 11:111212690-111212712 GCCTTTGGTGGCAAAGTTTGTGG - Intergenic
1089134468 11:116238231-116238253 GCCTTTGGGGGCCAGGCCTGCGG - Intergenic
1089688847 11:120173512-120173534 GCCTCTGGGGGCAGTTTCTGTGG - Intronic
1089878868 11:121754015-121754037 GCCTTTGGTGGGAAGATTTTGGG + Intergenic
1202812542 11_KI270721v1_random:33216-33238 GCCTCTGGAGGCAAGATGTGGGG + Intergenic
1091589696 12:1835935-1835957 GCCATTGGTGGCACCCTCTGGGG + Exonic
1097147106 12:56949266-56949288 GCCCTTGGTGGCGAGGTTTGCGG + Intergenic
1101041731 12:100762352-100762374 GCCTGAGGTGGCTAGTTCTGGGG - Intronic
1101947372 12:109147947-109147969 GACTTTGGAGACTAGTTCTGGGG + Intronic
1102522934 12:113490454-113490476 GCCTTTGGATGGAAGCTCTGGGG + Intergenic
1103586728 12:121961710-121961732 CCCTTTGCAGGGAAGTTCTGAGG + Intronic
1108273605 13:48786621-48786643 CCCTTTGGTGTCAAATTTTGAGG + Intergenic
1108478698 13:50844890-50844912 ACCTTTGCTGGCAAGTTGGGAGG - Intergenic
1108712904 13:53051482-53051504 GCCTTTGGAAGGAAGTTATGAGG - Exonic
1109894794 13:68671355-68671377 GCCTATGATGGTAAGTTCTATGG + Intergenic
1111052976 13:82909366-82909388 CCATTTTGTAGCAAGTTCTGTGG - Intergenic
1112009999 13:95285814-95285836 ACCTTTGGTGGCATCTTCTTTGG - Intronic
1112111996 13:96311396-96311418 GCAATTGGTGGGAAGTTGTGGGG + Intronic
1114960893 14:27887678-27887700 GCCTATGGTGCTAAGTTCTTTGG + Intergenic
1116176183 14:41473301-41473323 GCCTTCGGTGACAAGGTTTGAGG + Intergenic
1116242213 14:42359402-42359424 GCCTTTGGGGGAAGTTTCTGAGG + Intergenic
1116391206 14:44391959-44391981 GGCTTAGGTGGTAAGTTCTCAGG - Intergenic
1117606092 14:57430752-57430774 GCCCTTGGTGGCAAGGTTTGTGG - Intergenic
1118950270 14:70430182-70430204 GCCTTTTGTTGCAATTTCTTTGG + Intergenic
1119259537 14:73229338-73229360 GCCTTAGGTGGAGAGTTCTCTGG + Intergenic
1119939203 14:78622741-78622763 CCATTTGTTGGCAAGATCTGTGG + Intronic
1121011612 14:90523243-90523265 GCCATTGGTGACCAGCTCTGCGG - Intergenic
1121015989 14:90549400-90549422 GACTGTGGTGGCAGCTTCTGGGG + Intronic
1122281062 14:100622658-100622680 GCCTTCAGTGGCCAGTTATGGGG - Intergenic
1123404836 15:20013326-20013348 GGCTTTGGTGCCAATTTCTGAGG + Intergenic
1123514167 15:21019974-21019996 GGCTTTGGTGCCAATTTCTGAGG + Intergenic
1126216164 15:46157348-46157370 TCCCTTGGTGGCAAGGACTGTGG - Intergenic
1127686652 15:61352179-61352201 GCCTTAGGTGGCATGTTTTTAGG + Intergenic
1130980174 15:88807099-88807121 GCCCTAGGTGGCAGGTGCTGGGG + Intronic
1133208658 16:4249888-4249910 GCCTTTGGTGCCATGATTTGGGG - Intergenic
1134786849 16:16952435-16952457 GCCTTAGGAGGCAAGTTCTTTGG + Intergenic
1135399038 16:22152959-22152981 GCCTTTGTTGGAAATTTATGTGG + Intronic
1135695915 16:24586261-24586283 GGGTGTGGTGGCACGTTCTGTGG - Intergenic
1136353716 16:29729561-29729583 GCCTTTGGTGGTGAGAGCTGGGG - Intergenic
1137555717 16:49469125-49469147 GCCTTTGGGGGCAGGTGCTTGGG - Intergenic
1139531056 16:67542949-67542971 GACTTGGGTGGGGAGTTCTGGGG - Exonic
1140126300 16:72121553-72121575 GCCCTTGGGGGCAGGCTCTGAGG + Intronic
1140793811 16:78416566-78416588 GTCTTTGGTAGCAAGTTCCTTGG + Intronic
1141698648 16:85632483-85632505 GCCTTTGGTGGCAAGTTCTGGGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1144478795 17:15612078-15612100 TCATTTAGTGGCAAGTTCAGAGG - Intronic
1144919507 17:18751655-18751677 TCATTTAGTGGCAAGTTCAGAGG + Intronic
1147202207 17:38810300-38810322 GCATTAGATGGCAAGCTCTGTGG + Intronic
1147241375 17:39092852-39092874 GCCGTTGTTGCCAATTTCTGTGG + Intronic
1147384636 17:40074109-40074131 CCCTTTGGTGGCAACATTTGGGG - Intronic
1148139153 17:45316503-45316525 GCCTTTCATGGGAAGTTCTCAGG - Intronic
1149657520 17:58318169-58318191 GAGTTGGGTGGCAACTTCTGGGG - Intronic
1151508409 17:74543880-74543902 GCCTGAGGGGGCAATTTCTGGGG + Intronic
1151969468 17:77450395-77450417 GCCTTTGGTGACACCTTCTGAGG - Intronic
1154273629 18:12940940-12940962 GCCTGTGGTGGCCTCTTCTGAGG - Intergenic
1160263471 18:77317518-77317540 ACCTGTGGTGGTAAGTTTTGAGG + Intergenic
1161257020 19:3315201-3315223 GCCTGTGATGGGATGTTCTGAGG + Intergenic
1165089081 19:33373391-33373413 GCCTTTGGAAGCATTTTCTGAGG - Exonic
925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG + Intergenic
927069342 2:19509820-19509842 GCCTCTGTTGGCAAGTTTTAAGG + Intergenic
928810758 2:35222030-35222052 CCCTTTGATGGAAAATTCTGTGG + Intergenic
931646194 2:64424305-64424327 GCCTTGTATGGCAAGATCTGTGG - Intergenic
934606305 2:95698105-95698127 GCCTCTGTTGGAAAGTCCTGTGG + Intergenic
935532604 2:104253444-104253466 GCCTGTGGTGGCAAGGTTTGAGG - Intergenic
936795366 2:116196656-116196678 GCCCTTGGTGTCAAGGTTTGTGG + Intergenic
939596248 2:144126764-144126786 GCCTTTGGGGTCTAGTTGTGTGG - Intronic
943923218 2:193737845-193737867 GCCCTTGGTGGCAAGGTCTGTGG - Intergenic
944513417 2:200486751-200486773 GCCTGTGGTGGCAAGTTGTTCGG - Intergenic
945045120 2:205775040-205775062 GCCATGGGTGGGAAGTGCTGCGG - Intronic
945922024 2:215764426-215764448 GCCTTTTGTGGGAAGTTTTGAGG - Intergenic
947739028 2:232476486-232476508 GCCTCTGGGGGCAGGTTCTGCGG - Intergenic
1169087686 20:2837643-2837665 GCCTTTGGTGGAGGCTTCTGAGG - Intronic
1169843238 20:9962503-9962525 GCCTGTGTTGCCAAGGTCTGTGG - Intergenic
1172240950 20:33412245-33412267 GCATCTCCTGGCAAGTTCTGGGG + Intronic
1176236876 20:64057563-64057585 GCCTCTGGGTGCAAATTCTGAGG + Intronic
1178207587 21:30487338-30487360 GGCTTTGGTGGCATGTGCTATGG - Exonic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1183914807 22:41109142-41109164 GCCTTTGGTGGCAGCTACTAAGG + Intronic
1184684622 22:46090509-46090531 GCCTCTGGTGGGAAGGGCTGGGG + Intronic
1185066092 22:48632418-48632440 CCCTTTGGTGCCAAGTTTTGGGG + Intronic
949180018 3:1117691-1117713 GCATTGGTTAGCAAGTTCTGGGG - Intronic
952125035 3:30290608-30290630 GCCCCTGGTGCCAAGTGCTGGGG - Intergenic
952415991 3:33092160-33092182 GCCTTTGGGGGCAAGGTCAGGGG - Exonic
955395654 3:58555487-58555509 CCCCTTGGTGGCAAGTGCAGAGG - Intergenic
957133776 3:76257518-76257540 GCATTTGGTGGCAATTTCCTTGG - Intronic
957900413 3:86481740-86481762 GCCCATGGTGGCAAGGTTTGTGG + Intergenic
962679307 3:137782096-137782118 GCCTCTGGTGGAATGGTCTGTGG + Intergenic
965047373 3:163597101-163597123 GCCTGTGGTGGCAAGGCTTGTGG - Intergenic
972294611 4:37724739-37724761 GCCTTTGCTGCCAGTTTCTGAGG + Intergenic
973802883 4:54496340-54496362 GTCTTTGCTGGCTTGTTCTGGGG - Intergenic
975109318 4:70606309-70606331 GCCTTTGGTGGCAGCCACTGGGG - Exonic
975830780 4:78366423-78366445 CACTTTGGAGGCAAGTTCTAGGG - Intronic
977935449 4:102797831-102797853 GGCCTTGGTGGAAATTTCTGTGG - Intronic
979878715 4:125928017-125928039 GCCCTTGGTGGCAAGGATTGTGG - Intergenic
980591416 4:134894300-134894322 GCCTTTGGTGTCAATTACTTGGG - Intergenic
980686739 4:136239681-136239703 TCCCTTGGTGGCAAGGTTTGTGG - Intergenic
981025555 4:140073741-140073763 GCCTTGATTGGAAAGTTCTGAGG + Intronic
985148429 4:186919467-186919489 GCCTTTGCGGCCAAGTTCTAGGG + Intergenic
986705212 5:10448831-10448853 GCCTCTGGTGTCCAGTGCTGTGG + Intronic
987443983 5:17993345-17993367 GCATGTGGTAGCAAGTGCTGTGG - Intergenic
988419099 5:30984209-30984231 GGCTTTGGAGGCTATTTCTGTGG - Intergenic
988461731 5:31444991-31445013 GCCATTGCTGGCAATTTTTGTGG + Intronic
998058058 5:139096295-139096317 GCCTGTGGCGGCAAGGTTTGTGG - Intronic
1000270113 5:159676469-159676491 GTCCTTGGTGGCAAGGTTTGTGG - Intergenic
1002198205 5:177512560-177512582 GCCCTTGGAGGCAACGTCTGTGG + Exonic
1002485768 5:179535229-179535251 GGCTTTGGTAGAAAGGTCTGGGG + Intergenic
1004600130 6:17141667-17141689 TTCTTTAGTGGCAATTTCTGAGG + Intergenic
1007159205 6:39775210-39775232 GCCTCGGGTTGCAAGTTCTGAGG - Intergenic
1007359580 6:41345516-41345538 GCCCTTGGTGGCGGGTGCTGGGG - Intronic
1013275347 6:108579655-108579677 GCCTCTGCTTGCATGTTCTGGGG + Intronic
1015766000 6:136717380-136717402 CTCTTTGGTGGCAAATTCTCAGG - Intronic
1018016137 6:159714001-159714023 GCTCTTGGTGGCAAGTTTGGCGG + Intronic
1019036347 6:169062888-169062910 GCCCTTGGTGGTGAGATCTGTGG + Intergenic
1020247612 7:6442083-6442105 GAGTTTGGTGGAAGGTTCTGGGG - Intronic
1029042591 7:97593228-97593250 GCCTGTGGTGGCAAGGCTTGCGG + Intergenic
1029912030 7:104163344-104163366 CCCTTTAGTGGCAACTTCAGAGG + Intronic
1030230088 7:107198690-107198712 TCATTTGGAGGCAAATTCTGAGG + Intronic
1030857652 7:114581306-114581328 GCCTGTGGTGCCAACTACTGGGG - Intronic
1032971933 7:137174734-137174756 ACCCTTGGTGGCAAGGTTTGTGG - Intergenic
1035521543 8:278436-278458 GCCTTTGGAGGTAAGTTCGGCGG + Intergenic
1036190006 8:6661647-6661669 GCTCTTGGTGCCAAGCTCTGAGG - Intergenic
1041448655 8:57983326-57983348 GCCGTTTGTGGCATGGTCTGTGG + Intergenic
1042980022 8:74516805-74516827 GCCTGTGGTGGCAAGGCTTGGGG - Intergenic
1043661002 8:82740757-82740779 GCCTTTGTAGGAAAGGTCTGAGG - Intergenic
1045506601 8:102782921-102782943 GCCTTTTGTGACATGTTCTCAGG + Intergenic
1052263293 9:26542438-26542460 TTCTTTGGTGGAGAGTTCTGTGG - Intergenic
1053624964 9:39860072-39860094 GCCTCTGGTAGCAAGAGCTGAGG - Intergenic
1053879906 9:42583156-42583178 GCCTCTGGTAGCAAGAGCTGAGG + Intergenic
1054218933 9:62390626-62390648 GCCTCTGGTAGCAAGAGCTGAGG + Intergenic
1054231784 9:62518543-62518565 GCCTCTGGTAGCAAGAGCTGAGG - Intergenic
1057914478 9:99045246-99045268 TCTTTAGCTGGCAAGTTCTGTGG - Intronic
1058940781 9:109810904-109810926 GCCTGTGGTGGCTTGGTCTGTGG + Intronic
1060851518 9:126880606-126880628 CCCTTTGTGTGCAAGTTCTGTGG + Exonic
1062511590 9:136909351-136909373 GCCTTTGGTGGAAATGTCTCTGG + Intronic
1062538076 9:137029522-137029544 CCCTCTGGTGGCCAGTGCTGGGG - Intronic
1186351411 X:8743357-8743379 GACTTTGGAAGCAAGTTCTGGGG - Intergenic
1186414347 X:9370341-9370363 CTCTTTGGTGCCCAGTTCTGGGG - Intergenic
1187639453 X:21272827-21272849 GCCCATGGTGGCAAGTCTTGTGG - Intergenic
1187831183 X:23382680-23382702 GCCCTTGTTTGCAATTTCTGAGG + Intronic
1191669528 X:63736116-63736138 GTCTTTGGTTTCAAGGTCTGAGG - Intronic
1193204944 X:78736995-78737017 GCTCTTGGTGGCAAGGTTTGTGG + Intergenic
1193274276 X:79567941-79567963 GTTTTTGGTGGAGAGTTCTGTGG + Intergenic
1194023480 X:88723186-88723208 GCCCTTGGTGGCAAGATTTATGG - Intergenic
1194372588 X:93091873-93091895 GCCCTTGGTGGTAAGGTTTGTGG + Intergenic
1194391460 X:93322428-93322450 GACCTTGGTGGCAAGGTATGTGG + Intergenic
1196013762 X:110915801-110915823 GCCTTTGATGGCATTTGCTGTGG - Intergenic
1196253260 X:113486360-113486382 GCCCTTGGTGGCAAGGTTTGTGG + Intergenic
1198996757 X:142581106-142581128 GCCTTCGGTGGCAAGGTTTATGG + Intergenic
1199110983 X:143934572-143934594 GCCCTTAGTGGCAAGATTTGTGG + Intergenic
1199778367 X:151035517-151035539 TCCATTGATGGCAAGTTCTGGGG + Intergenic
1200680625 Y:6205916-6205938 GCCCTTGGTGGTAAGGTTTGTGG + Intergenic