ID: 1141698879

View in Genome Browser
Species Human (GRCh38)
Location 16:85633367-85633389
Sequence TCTGCCCCACGTTACAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141698879_1141698880 -2 Left 1141698879 16:85633367-85633389 CCTTTTCTGTAACGTGGGGCAGA 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1141698880 16:85633388-85633410 GAACTCCCGCCAGTCTTCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1141698879_1141698885 18 Left 1141698879 16:85633367-85633389 CCTTTTCTGTAACGTGGGGCAGA 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1141698885 16:85633408-85633430 AGGGCATTGCCATGCGTGCCTGG No data
1141698879_1141698881 -1 Left 1141698879 16:85633367-85633389 CCTTTTCTGTAACGTGGGGCAGA 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1141698881 16:85633389-85633411 AACTCCCGCCAGTCTTCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141698879 Original CRISPR TCTGCCCCACGTTACAGAAA AGG (reversed) Intronic
902195919 1:14798008-14798030 TCTCCCCCACTTTACAGATGAGG + Intronic
902394226 1:16123889-16123911 GCGGCCCCATTTTACAGAAAAGG - Intergenic
902400998 1:16156686-16156708 TCATCCCCATGTTACAGAAGAGG + Intergenic
902669333 1:17961770-17961792 TCTTCCCCACCTTACACAAGTGG + Intergenic
902885320 1:19400558-19400580 ACTTCCCCACGTGCCAGAAAAGG - Intronic
903141506 1:21342015-21342037 TCTGCCCCACTTTGTAGGAAAGG + Intronic
903563176 1:24244562-24244584 TCTGACCCAAGTGACAGAACTGG + Intergenic
903579717 1:24361719-24361741 TCTTCCCCTCCTTCCAGAAAGGG + Intronic
903687686 1:25143913-25143935 TCTGCTCCTTGCTACAGAAAGGG + Intergenic
904782618 1:32962779-32962801 TCTGCCCAAGGTCACAGAACAGG + Intronic
905205861 1:36342557-36342579 TTAGCCCCATGTTACAGAAGAGG - Intronic
906725390 1:48040497-48040519 TCCTCCCCACATTACAGAAAAGG - Intergenic
906951307 1:50336262-50336284 TCTGTCCAAGGTTACAGGAAAGG - Intergenic
907208299 1:52794852-52794874 TCTACTCCACGTGATAGAAATGG - Intronic
907360826 1:53913190-53913212 ACTGCCCCACCTTGCAGCAAGGG - Intergenic
910525740 1:88175936-88175958 TCTGCCCCTGGTTACAGGAAAGG + Intergenic
913124120 1:115769490-115769512 TCAGCCCCACTTTACATAGAGGG - Intergenic
915105374 1:153532290-153532312 CCTGCCCCAGTTTACAGAGATGG + Intergenic
917358790 1:174154623-174154645 ACTGCCCCACATAAAAGAAAAGG + Intergenic
917441889 1:175075754-175075776 TCATTCCCACGTTACAGACAAGG + Intronic
920648124 1:207818157-207818179 TCTGCCCCACGCTCCAGCAGAGG + Intergenic
921273578 1:213494128-213494150 CCTGCCCCCGGCTACAGAAATGG + Intergenic
1062843461 10:688570-688592 CCCACCCCACGTTACAGGAATGG + Intronic
1067450387 10:46378456-46378478 GATGCCTCACTTTACAGAAAGGG - Intronic
1067586858 10:47481307-47481329 GATGCCTCACTTTACAGAAAGGG + Intronic
1067633913 10:47989074-47989096 GATGCCTCACTTTACAGAAAGGG + Intergenic
1067663257 10:48252226-48252248 TAAGCCCCATGTTTCAGAAAGGG + Intronic
1068544464 10:58330271-58330293 TCTACCCCACTTTATAGAATTGG + Intergenic
1068739714 10:60454961-60454983 ATTGCCACATGTTACAGAAATGG - Intronic
1070480837 10:76881300-76881322 TCAGCCCTATTTTACAGAAAAGG - Intronic
1072519781 10:96221141-96221163 TCAGCCCCACTTTACAGATGAGG - Intronic
1074500202 10:114016917-114016939 TCTGTCCCATTTTACAGACAAGG + Intergenic
1075934987 10:126332718-126332740 TCTGCCTCATTTTACGGAAAAGG - Intronic
1078655961 11:13239390-13239412 TTTTCCCCACCTTACAGATAGGG + Intergenic
1080181566 11:29432059-29432081 TCTGCCTCATGTCACATAAATGG + Intergenic
1081568891 11:44277388-44277410 TTTTCCCCAAGTTACAGACAAGG - Intronic
1083783848 11:64932755-64932777 TCTGCCCCAGGTTGCAGAGCGGG + Exonic
1083804110 11:65063660-65063682 TCTGCCCCTCACTAGAGAAATGG + Intergenic
1084493929 11:69492951-69492973 AATGCCCCACGTCAAAGAAATGG + Intergenic
1085409892 11:76284660-76284682 TCTGCCCCACTTTACAGAGGGGG - Intergenic
1085457311 11:76672319-76672341 TCTTTCCCACTTTACAGATAGGG - Intergenic
1085706427 11:78790360-78790382 TCAACCCCATTTTACAGAAATGG - Intronic
1088745490 11:112801024-112801046 TCACCCCCACCTTAGAGAAAAGG + Intergenic
1090700781 11:129293721-129293743 TCATCCCCACTTTACAGATAAGG + Intergenic
1091784588 12:3235451-3235473 TTTGCCCCATTTTACAGATAAGG - Intronic
1091804922 12:3348961-3348983 TCTTCCCCACGTTACAGAAGGGG + Intergenic
1094526952 12:31237506-31237528 TTTGCCCCACTTTACAGATGAGG + Intergenic
1101571284 12:105956199-105956221 TCATCTCCACTTTACAGAAAAGG + Intergenic
1102532502 12:113557125-113557147 ATTACCCCATGTTACAGAAAAGG + Intergenic
1104710648 12:130983304-130983326 ACTGCCCCACTTTACAGAGGTGG - Intronic
1104740007 12:131165236-131165258 TCTGTCCCACGGTGGAGAAAGGG + Intergenic
1109492896 13:63126797-63126819 GCTGCCTCATGTGACAGAAAGGG + Intergenic
1109723096 13:66302054-66302076 ACTGCCCCAAGATACAGACAGGG - Intergenic
1114947165 14:27697828-27697850 TCTGCCCAAGGAAACAGAAAAGG + Intergenic
1115634856 14:35281393-35281415 TCTTCCCCACTTAACAGAAAAGG - Intronic
1117656215 14:57959455-57959477 TTAGCCCCGGGTTACAGAAAAGG + Intronic
1118086538 14:62424436-62424458 GGTGACCCACTTTACAGAAAAGG - Intergenic
1118707008 14:68489524-68489546 TTTCCCCCATTTTACAGAAATGG - Intronic
1122078327 14:99249708-99249730 TCAGCCCCACTTTATAGAAGAGG - Intronic
1124654539 15:31497838-31497860 TCTTCCCCACTTTACAGAGGGGG - Intronic
1125584093 15:40808004-40808026 TTAGCCCCATTTTACAGAAATGG - Intronic
1126468134 15:48979348-48979370 TCAGCCCCATTTTACAGATAAGG - Intergenic
1126902794 15:53331184-53331206 TTTTTCCCACGTTACAGATAAGG - Intergenic
1133320423 16:4910155-4910177 TTATCCCCATGTTACAGAAAGGG + Intronic
1133352859 16:5113752-5113774 TCATCCCCAAGTTACAGACAAGG - Intergenic
1133724822 16:8527675-8527697 TGGGCCCCACTATACAGAAAAGG + Intergenic
1134015909 16:10888255-10888277 TATCCCCCACTTTACAGATAAGG + Intronic
1134487867 16:14672911-14672933 TCAGCCCCATTTTACAGAAAAGG + Intronic
1134502497 16:14780139-14780161 TCTCCCCCACCTTACAGATCAGG - Intronic
1134562575 16:15223358-15223380 GCTACTCCACGTAACAGAAATGG + Intergenic
1134578065 16:15348755-15348777 TCTCCCCCACCTTACAGATCAGG + Intergenic
1134724526 16:16408791-16408813 TCTCCCCCACCTTACAGATCAGG - Intergenic
1134923115 16:18134985-18135007 GCTACTCCACGTAACAGAAATGG + Intergenic
1134942906 16:18303068-18303090 TCTCCCCCACCTTACAGATCAGG + Intergenic
1137669401 16:50270746-50270768 TCAGCCCCATTTTACAGATAAGG - Intronic
1138170530 16:54845070-54845092 TTTGGCCCACGTTCAAGAAAAGG + Intergenic
1140016853 16:71195795-71195817 TTTGACCCATGTTAAAGAAAAGG + Intronic
1141383155 16:83594320-83594342 TCTCCCCCACTTTACAGATGAGG + Intronic
1141698879 16:85633367-85633389 TCTGCCCCACGTTACAGAAAAGG - Intronic
1143099562 17:4498014-4498036 TCTGCCCCCAGATACAGAAATGG + Intergenic
1144635449 17:16904743-16904765 TGTCCCCCACCTGACAGAAATGG + Intergenic
1145244892 17:21262263-21262285 TCAGCCTCACTTTACAGAGAGGG + Intergenic
1145909107 17:28532513-28532535 TCTGACCCACTTTACAGACTGGG - Intronic
1146164881 17:30579983-30580005 TGTCCCCCACCTGACAGAAATGG + Intergenic
1147587043 17:41658755-41658777 TTTTCCCCATTTTACAGAAAAGG + Intergenic
1149146797 17:53504265-53504287 TCAGCCCCATTTTACAGATAAGG + Intergenic
1152681680 17:81671734-81671756 TCTTCCCCAGGTTCCAGAAGCGG + Exonic
1153943692 18:9999106-9999128 TATGCCCCACATTACAGTATTGG - Intergenic
1156465536 18:37346088-37346110 CCTGCTCCACACTACAGAAATGG - Intronic
1158877719 18:61749071-61749093 TGTGGCCCATGTTACAGAACTGG - Intergenic
1158951563 18:62499894-62499916 TCTGCCCCACGTCCCTGCAAAGG + Intergenic
1158987255 18:62830597-62830619 TCTACCCCATATCACAGAAATGG - Intronic
1159249260 18:65852531-65852553 TGTGCCCCAGGTGAGAGAAAGGG + Intronic
1160251538 18:77207622-77207644 TGTGCCCCATTTTACAGAGAAGG - Intergenic
1160298562 18:77658685-77658707 GGTGCCCCAAGTTCCAGAAAGGG + Intergenic
1163131356 19:15275346-15275368 TCATCCCCACTTTACAGATAGGG + Intronic
1164966176 19:32486743-32486765 TCTGCCCCTCCTTTCAGATAAGG + Intergenic
1165863131 19:38919566-38919588 TCATCCCCACTTTACAGAGAGGG - Intronic
1166254920 19:41596782-41596804 CCTGCCCCACTTTACAGATGTGG - Intronic
1166275187 19:41748670-41748692 CCTGCCCCACTTTACAGACGTGG - Intronic
1166280204 19:41787466-41787488 CCTGCCCCACTTTACAGACATGG - Intergenic
1166396532 19:42445261-42445283 CCTGCCCCACTTTACAGACATGG + Intergenic
1166412504 19:42565475-42565497 CCTGCCCCACTTTACAGACATGG + Intergenic
1167169969 19:47824451-47824473 TCATCCCCACTTTACAGAGAAGG - Intronic
1167345069 19:48940368-48940390 GCTGCCCCACTTTGCAGAAGAGG + Intronic
925185671 2:1844618-1844640 TCTGCCCCAAAATACAGACAAGG - Intronic
925248594 2:2409139-2409161 TCTGCCCCATATTACAGACGAGG - Intergenic
928210940 2:29323124-29323146 ACTGCCCCATTTTACAGATAAGG - Intronic
929420925 2:41788819-41788841 TTTGCCCAAGGTTACACAAAAGG + Intergenic
930011754 2:46942637-46942659 TTTGTCCCACTTTACAGATAAGG + Intronic
930888682 2:56357796-56357818 TCTGACTCAGGTTACAGACAGGG + Intronic
932948288 2:76262742-76262764 TATGCCCCAGGCTACAGAAGGGG + Intergenic
935208262 2:100915354-100915376 TCTGGCCAACGGAACAGAAAGGG + Intronic
938380104 2:130831776-130831798 TCTTCCCCAAGTCACAGACAGGG - Intergenic
940776801 2:157893379-157893401 TCTACTCCACTTTACAGAAAAGG - Intronic
941511740 2:166419093-166419115 TCTGCCCCAATTTAGAGAAAAGG - Intronic
948322881 2:237085281-237085303 TCTGCTCTACGTTTCAGGAAAGG + Intergenic
948802373 2:240438682-240438704 TCTGCCCCAGGGACCAGAAAAGG + Intronic
1168966594 20:1902309-1902331 TCATCCCCACTTTACAGATAAGG + Intronic
1172635150 20:36405263-36405285 TTTGCCCAAGGTTACAGAGATGG - Intronic
1173736366 20:45364302-45364324 TCCGGCCCACTTTTCAGAAAAGG - Intronic
1175825388 20:61933965-61933987 TGTGGCCCAGGTGACAGAAAAGG + Intronic
1179041253 21:37804015-37804037 TCTGCCCCCAGTTAAAAAAATGG + Intronic
1179722698 21:43324609-43324631 TCAGCCCCATGTCACAGACAAGG + Intergenic
1180022807 21:45139587-45139609 CCTGCCCCACGTGACAGAGGAGG - Intronic
1180847960 22:18994754-18994776 TCTGCCCCTCGCTTCAGAGATGG + Intergenic
1182036052 22:27199160-27199182 GTTGCCTCACTTTACAGAAAAGG - Intergenic
1182335090 22:29578731-29578753 ACATCCCCACTTTACAGAAAAGG + Intronic
1182806281 22:33073292-33073314 TCAGCCCCACTCTACAGAGATGG - Intergenic
1183259778 22:36787085-36787107 TCAGCCCCACTTTACAGATAAGG - Intergenic
1184444138 22:44537417-44537439 TCTTCCCCACATTTCAGAGAGGG - Intergenic
1184549027 22:45194498-45194520 TCTTCCCCGCATTACACAAAAGG + Intronic
949339825 3:3017520-3017542 TCTGCCCCAGGTTCCTGGAAGGG - Intronic
951803183 3:26619501-26619523 TCTGACACTCTTTACAGAAATGG - Intergenic
952276559 3:31882926-31882948 TTTGCCCCACATTAAAGAATAGG - Intronic
954880952 3:53835842-53835864 TCAGCCCCATGTCACAGAGAGGG + Intronic
955662084 3:61311636-61311658 TTTGCCCCATTTTACAGATAAGG - Intergenic
955993124 3:64649830-64649852 TCTCCCCCAGGTAACAGTAAAGG + Intronic
956317832 3:67958729-67958751 TGTTCCCCATTTTACAGAAAAGG - Intergenic
958906186 3:99944622-99944644 TCTGCCCCAAGCCACAGAACTGG + Intronic
961520923 3:127467028-127467050 TCAGCCCCACATTCCAGATAAGG + Intergenic
962752814 3:138446390-138446412 TTTGCCCCATTTTACAGATAAGG - Intronic
963298311 3:143572014-143572036 TCTGCCCCTCGGTACAGCCATGG + Intronic
970178002 4:13358740-13358762 TCTGTCCTACCTGACAGAAATGG - Intergenic
973063629 4:45761581-45761603 GCTGCCCCACATGACAGAAATGG - Intergenic
985048479 4:185966015-185966037 TAGGCCCCCCATTACAGAAAGGG - Intergenic
985845078 5:2338529-2338551 TCTGCACCACCTGACAGAACCGG - Intergenic
987060590 5:14239577-14239599 GCTGCCCCACTTTACAGGTAGGG + Intronic
988440696 5:31228919-31228941 TTTTCCCCACATTACAGGAAAGG - Intronic
988562729 5:32295709-32295731 TCATCCCCACTTTACAGATAAGG + Intronic
991399989 5:66241888-66241910 TTTGCCCCACAATCCAGAAATGG - Intergenic
993327600 5:86561355-86561377 TCAATCCCACTTTACAGAAAAGG + Intergenic
994144734 5:96382330-96382352 TATCCCCCACTTTACAGAGAGGG - Intergenic
996343494 5:122464657-122464679 TCTGCACCAGGATACAGGAATGG - Intergenic
999242239 5:150134591-150134613 TTTTCCCCATGTTACAGAAGAGG - Intronic
1000041328 5:157487275-157487297 TCTGCCCCACATAAAAGGAAGGG + Intronic
1000211606 5:159111670-159111692 TCTGCCCCACTTCACAGAGGAGG + Intergenic
1001199514 5:169703383-169703405 TATGCCCCATTTTACAGATAGGG + Intronic
1002397344 5:178968335-178968357 TCACCCCCATGTTACAGAAGAGG + Intergenic
1002699294 5:181111188-181111210 CCTGTCCCAGGCTACAGAAAGGG - Intergenic
1003377844 6:5595623-5595645 TCTTCCCCAGGTTACAGACTGGG + Intronic
1005524661 6:26634154-26634176 TCTGCACCACATTCCATAAATGG - Intergenic
1006046832 6:31306003-31306025 TCAGCCCCATTTTACAGACAAGG - Intronic
1007392561 6:41558530-41558552 TTGGCCCCACATTACAGATAAGG + Intronic
1007640651 6:43336785-43336807 CCTCCCCCACATTTCAGAAATGG + Exonic
1013803645 6:113972865-113972887 ACTGCCCCATTTTACAGATAAGG - Intronic
1014779708 6:125550167-125550189 GCTGCCCCATCTTACAGATAAGG + Intergenic
1016414826 6:143821168-143821190 TCTGCCCAAGGTTACAGTCAGGG + Intronic
1017382226 6:153844282-153844304 TTAGCCCCAAGTCACAGAAAAGG + Intergenic
1018063298 6:160107270-160107292 TATGCCCCTCCTTACAGAGAGGG - Intronic
1019362851 7:614420-614442 ACTGCCCCACTTCACAGACAAGG + Intronic
1019854981 7:3596410-3596432 TCTACCCATTGTTACAGAAATGG - Intronic
1020259007 7:6520326-6520348 TCTGCCTCACTTCACAGAGAAGG + Intronic
1023904754 7:44514062-44514084 CCTGCCCCAGGTTACAGACTTGG - Intronic
1024973861 7:55095293-55095315 TCTTCCCCACTGTACAGAAAAGG - Intronic
1026900251 7:74033113-74033135 TCTGCCCCATGTCACAAAAAAGG + Intronic
1031494885 7:122433907-122433929 TCTGCCCCAGGCTTCAAAAAGGG + Intronic
1031553655 7:123145238-123145260 TCATCCCCATTTTACAGAAAAGG + Intronic
1031790989 7:126104108-126104130 TCTCCCCTAGGTTAAAGAAATGG + Intergenic
1032696032 7:134337163-134337185 TCTCTCCCAAGTCACAGAAAGGG - Intergenic
1033578846 7:142713147-142713169 TCTGCCCTACATTAGGGAAATGG + Intergenic
1033615132 7:143007107-143007129 TCTGTCCCACGTTAAGGATAAGG - Intergenic
1034840474 7:154390999-154391021 TCCGCCCCATTTTACAGACAAGG - Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035437233 7:158868125-158868147 TCTGGCCCACGTTCGAGGAAGGG + Intronic
1039395835 8:37224397-37224419 TCTGCCCCTCACCACAGAAAAGG + Intergenic
1039449917 8:37664489-37664511 TCTGGCCCACATTTAAGAAAAGG - Intergenic
1044850226 8:96420114-96420136 TCTGTCACAGGTTACAGACAGGG + Intergenic
1045198301 8:99952385-99952407 TATGACCCAGCTTACAGAAAGGG + Intergenic
1046836777 8:118810539-118810561 TCTGCACCACTGTTCAGAAAAGG + Intergenic
1046860605 8:119087010-119087032 TTTGCTCCATTTTACAGAAAAGG - Intronic
1047957237 8:129985174-129985196 TCAGTCCCACTTTACAGAAGAGG - Intronic
1049610176 8:143551499-143551521 TCTGCCCTCCATGACAGAAATGG + Intergenic
1053098367 9:35348741-35348763 TCTCCCCCACTTTACAGATGAGG + Intronic
1057199313 9:93131880-93131902 TGTGCCCCATTTTACAGAAAAGG + Intronic
1057959847 9:99444641-99444663 TCTGGCCCATGTTAAAGAATTGG - Intergenic
1058625950 9:106932693-106932715 TCAGCCCCATTTTACAGAAAAGG - Intronic
1060578184 9:124717822-124717844 TCTGCCCCATTTTACAGATGAGG - Intronic
1191742012 X:64446418-64446440 TCTTCCCCATATTACAGATAAGG + Intergenic
1195965421 X:110425698-110425720 TTTCCCCCACGTTACAGAGCAGG + Intronic
1196706903 X:118724812-118724834 TCAGCCTCCAGTTACAGAAATGG + Intergenic
1199031006 X:143000284-143000306 TCAGCCCCATTTTACAGATAAGG + Intergenic
1199087361 X:143643133-143643155 TCCTGCCCACTTTACAGAAAAGG - Intergenic