ID: 1141700244

View in Genome Browser
Species Human (GRCh38)
Location 16:85639044-85639066
Sequence GTGCAACCCAGGATCAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141700244_1141700249 1 Left 1141700244 16:85639044-85639066 CCTGAGTTGATCCTGGGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1141700249 16:85639068-85639090 CCCAGCCCCTTCCCAGCGACCGG 0: 1
1: 0
2: 4
3: 50
4: 469
1141700244_1141700254 7 Left 1141700244 16:85639044-85639066 CCTGAGTTGATCCTGGGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1141700254 16:85639074-85639096 CCCTTCCCAGCGACCGGCCTGGG No data
1141700244_1141700252 6 Left 1141700244 16:85639044-85639066 CCTGAGTTGATCCTGGGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1141700252 16:85639073-85639095 CCCCTTCCCAGCGACCGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 204
1141700244_1141700260 25 Left 1141700244 16:85639044-85639066 CCTGAGTTGATCCTGGGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1141700260 16:85639092-85639114 CTGGGCTGCAGTCTGAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141700244 Original CRISPR GTGCAACCCAGGATCAACTC AGG (reversed) Intronic
900866008 1:5269143-5269165 AGGCATCCCAGGATCAACACAGG + Intergenic
901630690 1:10646846-10646868 GGGCTCCCCAGGATCAACTCGGG + Intronic
910076960 1:83292211-83292233 GTGCAATTCAGGGTCAATTCAGG - Intergenic
916560536 1:165930978-165931000 GTGGAACAAAGGAACAACTCTGG - Intergenic
922595531 1:226810079-226810101 ATGCAACCCAGGCCCAGCTCAGG + Intergenic
922857339 1:228786194-228786216 GTTCAAACCAGGATCAAATAAGG - Intergenic
923841654 1:237679084-237679106 GTGCACCCCAGGACAAACTTTGG - Intronic
1063198905 10:3768640-3768662 GTGCAACCCTGGGTCATCTCAGG + Intergenic
1067343991 10:45425025-45425047 GTGCAGCGCCGGATCAACACAGG - Exonic
1076804314 10:132847487-132847509 GGGCCACCCTGCATCAACTCAGG - Intronic
1083726565 11:64631417-64631439 AGGCAACCCAGGATCAGCCCAGG + Intronic
1089325162 11:117651969-117651991 GGGCAGCCCAGGCTCACCTCTGG + Intronic
1094644504 12:32308896-32308918 GTGAAAACCAGGTTCAACACAGG + Intronic
1104817130 12:131654088-131654110 GTGAAACCCAGAAACAACCCAGG - Intergenic
1108300464 13:49069291-49069313 GTGCCACAGAGGATTAACTCAGG - Intronic
1113925025 13:113936764-113936786 GTGCCACCCAGAAGCGACTCGGG - Intergenic
1117080784 14:52150297-52150319 GTGCAACCCAGTATTACCTCAGG - Intergenic
1124641271 15:31398001-31398023 GTAAAACCCAAGATAAACTCAGG - Intronic
1125658589 15:41378364-41378386 CTGCAACCCAGGATGAGCTCTGG - Intronic
1127746325 15:61979202-61979224 GTGGAAGCAAGGATCAATTCAGG + Intronic
1129231132 15:74197719-74197741 TTGCAAGCCAGGTTCAACTTGGG + Intronic
1131288462 15:91082937-91082959 TTGCCACCCAGTATCAATTCAGG - Intergenic
1132463859 16:68641-68663 GTGCATCCCAGGACCAGCTGGGG + Intronic
1134285936 16:12862250-12862272 GTGCAACCTAGGTTCCTCTCAGG + Intergenic
1135760655 16:25135636-25135658 GTGCAACCTAGGAACCATTCCGG - Intronic
1137629048 16:49929356-49929378 GTGCAACCCACAAGCAGCTCTGG - Intergenic
1138432090 16:56975491-56975513 TGGAACCCCAGGATCAACTCTGG + Intronic
1141700244 16:85639044-85639066 GTGCAACCCAGGATCAACTCAGG - Intronic
1141728246 16:85804816-85804838 TTGAAACCCTGGATCATCTCAGG - Intronic
1151772320 17:76172098-76172120 CTCCACCCCAGGGTCAACTCTGG - Intronic
1152117988 17:78400491-78400513 GTGTCACCTTGGATCAACTCTGG + Intronic
1155173191 18:23282315-23282337 GTTCTATCCAGGATCAACTGGGG - Intronic
1155217618 18:23657221-23657243 GTGAAGCCCAGGATGAAGTCAGG - Intronic
1155563816 18:27110580-27110602 GTGCAACCTAGAAACAACTGAGG - Intronic
1156312316 18:35935926-35935948 GTGCATCCCAGCATCAGCCCGGG + Intergenic
1156855087 18:41772662-41772684 GTGCTACCCAAGATGATCTCCGG + Intergenic
1158877131 18:61744274-61744296 ATGCAATCCAGGCTCAACTGAGG + Intergenic
927077719 2:19596865-19596887 GTGCAACCCTGGAAGGACTCAGG + Intergenic
928182434 2:29078707-29078729 GTGTATCCCACGAGCAACTCTGG - Intergenic
928241642 2:29591882-29591904 GTAAAACCCAGAATGAACTCAGG - Intronic
929627717 2:43427269-43427291 GTGCTAGCCAGGCTCAACACAGG + Intronic
931255736 2:60570493-60570515 GTGCCGCCCAGGATCAAATGGGG - Intergenic
940766281 2:157792963-157792985 CTGCAGCCCGGGATGAACTCAGG - Intronic
943947525 2:194087266-194087288 GTTCAAACCAGGTTCAAATCAGG + Intergenic
947170184 2:227303069-227303091 CTGGAATCCAGGATCACCTCTGG - Exonic
1172571856 20:35976802-35976824 CTCCAAGCCAGGATCAAGTCAGG - Intronic
1174796609 20:53527792-53527814 GTCCATCCCAGGAACAGCTCTGG + Intergenic
1175525880 20:59632997-59633019 GTGCACCCCAGGATCAAGGTGGG - Intronic
1176059475 20:63166097-63166119 GTGCGACCCAGGATACACTTTGG - Intergenic
1181431268 22:22883110-22883132 CTGCAACCCAGGATCATCAGAGG + Intronic
1181431495 22:22884478-22884500 CTGCAACCCAGGATCACCAGAGG + Intronic
958077880 3:88707870-88707892 GTGCATCCCAGGATGAACGAAGG - Intergenic
966530939 3:180979064-180979086 ATGGAACCCAGCATCATCTCAGG - Exonic
967958632 3:194900553-194900575 GTGCATACCAGCATCTACTCTGG + Intergenic
969315479 4:6379063-6379085 GTGGAATCCAGGAGCAAGTCAGG - Intronic
973602908 4:52559726-52559748 GTGTAACCCTGGATAAACTGAGG + Intergenic
982367527 4:154596170-154596192 GTGCAACTCAGAATCACTTCTGG - Intergenic
982745428 4:159101321-159101343 GTGCAATCCAGCATCATGTCTGG - Intergenic
992699616 5:79328886-79328908 CTGAAACACAGGATTAACTCTGG + Intergenic
997870720 5:137502963-137502985 TTGCAACCCATTATCCACTCAGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
998263392 5:140648194-140648216 GCGCAACCCAGGATTAAGTATGG - Intronic
1000622910 5:163505623-163505645 CTCCAACCCAGGATCGACGCGGG - Exonic
1009331178 6:62422600-62422622 ATGCAACCCACGTACAACTCAGG - Intergenic
1022090982 7:27108111-27108133 GTGGAGCCCATGAGCAACTCCGG - Exonic
1023572041 7:41582298-41582320 GTACTACCCAGGAGCAAGTCTGG + Intergenic
1024316084 7:48018086-48018108 GTGCAACCCAGTATCTTCTTGGG - Intronic
1025251340 7:57353421-57353443 GTGCAGACCAGGCTCAGCTCAGG + Intergenic
1027294730 7:76757427-76757449 GTGCAATTCAGGGTCAATTCAGG - Intergenic
1030754132 7:113268247-113268269 TTGCCACCCAGGATAAACTGTGG - Intergenic
1033277508 7:139983804-139983826 CTGCAAACCAGGATGAACTGTGG - Intronic
1035731917 8:1859706-1859728 GGGGAACCCAGCATCACCTCTGG - Intronic
1040333014 8:46401844-46401866 GTGCTAGCCAGCATAAACTCAGG - Intergenic
1048384484 8:133898870-133898892 GTGCAACACAGGATTATGTCAGG - Intergenic
1048609099 8:136002520-136002542 TTGCAACCCAGGAATAACACTGG - Intergenic
1049825371 8:144664247-144664269 CAGCAACCCAGGCTCTACTCAGG - Intergenic
1050106426 9:2170929-2170951 CTGCATGCCATGATCAACTCTGG - Intronic
1050656488 9:7834046-7834068 GTGAAACCCTAGGTCAACTCAGG - Intronic
1196762894 X:119215697-119215719 GTCCTACCCAGAAGCAACTCAGG - Intergenic
1202130631 Y:21605567-21605589 GTGCGACCCAGGATGAACGGAGG - Intergenic