ID: 1141700450

View in Genome Browser
Species Human (GRCh38)
Location 16:85639817-85639839
Sequence TGCTTGCCGTGTGCAGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141700444_1141700450 18 Left 1141700444 16:85639776-85639798 CCAGGGCTGCTGCCAGGCACCCT 0: 1
1: 0
2: 12
3: 107
4: 630
Right 1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1141700448_1141700450 -2 Left 1141700448 16:85639796-85639818 CCTCGCAAGCTGTGTGGCATCTG No data
Right 1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1141700447_1141700450 -1 Left 1141700447 16:85639795-85639817 CCCTCGCAAGCTGTGTGGCATCT 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1141700445_1141700450 6 Left 1141700445 16:85639788-85639810 CCAGGCACCCTCGCAAGCTGTGT 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141700450 Original CRISPR TGCTTGCCGTGTGCAGCAGG CGG Intronic
900367314 1:2316471-2316493 TGGTTGCCGTGGGCGGGAGGTGG + Intergenic
900386490 1:2413201-2413223 TGCCTCCCGTGGGCACCAGGGGG - Intronic
906443360 1:45871315-45871337 TGCTTGTAGTGTTCAGGAGGGGG - Intronic
906449121 1:45929366-45929388 TGTTTGCCCAGAGCAGCAGGGGG + Intronic
907518388 1:55007624-55007646 TGCTTGTCGTGAGTAGCAGGGGG + Intronic
909238414 1:73181272-73181294 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
910914893 1:92278091-92278113 TGCTTGCCGTGAAGGGCAGGGGG + Intronic
918282634 1:183022388-183022410 TGCTTGCCGTATCCAGCACTGGG + Intergenic
919075624 1:192809212-192809234 AGCTTGCAGTGTGGGGCAGGGGG - Intronic
919083374 1:192891977-192891999 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
920263456 1:204705482-204705504 TGGGTGCCGTAGGCAGCAGGGGG - Intergenic
923495614 1:234521908-234521930 AGCAAGCCGTGTGCAGCATGGGG - Intergenic
924595883 1:245444239-245444261 TGGTTGCCGTGGGGAGGAGGCGG + Intronic
1063306701 10:4909322-4909344 TTCATGGCCTGTGCAGCAGGAGG + Intergenic
1066273191 10:33843724-33843746 TGTTTCCCATGTGCTGCAGGAGG - Intergenic
1072154826 10:92714939-92714961 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
1072740666 10:97907229-97907251 TGCATGCCACGGGCAGCAGGAGG + Intronic
1075602356 10:123779344-123779366 TGCATACCGAGTGCAGAAGGGGG - Intronic
1076331692 10:129675122-129675144 TGCTTGCCGTGCAAAGCAGCAGG + Intronic
1079733199 11:23962041-23962063 TGCTCGCTCTGTGGAGCAGGAGG - Intergenic
1081587688 11:44398528-44398550 AGCTGGCCGGGAGCAGCAGGGGG + Intergenic
1084356359 11:68641364-68641386 GGCTGGCCCTGAGCAGCAGGGGG + Intergenic
1084392885 11:68890300-68890322 TGTTCTCCGCGTGCAGCAGGGGG - Intergenic
1086039468 11:82458374-82458396 TGCTTGCTGTTTGGAGGAGGAGG - Intergenic
1086760822 11:90628353-90628375 TGCCTGCCATGTGAAGCAGCTGG - Intergenic
1086952723 11:92907633-92907655 TGCTTGCTGTGTGGGGCATGAGG + Intergenic
1089384193 11:118057342-118057364 TGCTTCCTCTGTGCAGTAGGAGG + Intergenic
1090441463 11:126728573-126728595 TAATTCCTGTGTGCAGCAGGTGG - Intronic
1090657049 11:128854193-128854215 TGCTTGGCTGGTGCAGTAGGAGG - Intronic
1091537938 12:1430738-1430760 TGGTTGCAGTCAGCAGCAGGTGG + Intronic
1092793051 12:12085969-12085991 TGGATGCCGTGTGGAGCAGCTGG - Intronic
1098867584 12:75780527-75780549 TGGTTGCTGTTTGCGGCAGGAGG - Intergenic
1101963386 12:109266078-109266100 TGATGGTCCTGTGCAGCAGGAGG - Intronic
1104718966 12:131034062-131034084 TGGCTGCTGTGTGCAGCTGGGGG - Intronic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1108088172 13:46818050-46818072 TGCTTGCTCTGTAGAGCAGGAGG - Intergenic
1113242251 13:108350786-108350808 TGCTTGCCTAATGCAGCAGGTGG + Intergenic
1115545654 14:34462709-34462731 TCCTTACCTTGTGCAGCTGGCGG + Intronic
1115631789 14:35252732-35252754 TGTTTTCTGTGTGCAACAGGAGG - Intronic
1117881290 14:60315910-60315932 TGATTACTGTGAGCAGCAGGGGG + Intergenic
1121632592 14:95432044-95432066 TGCTAGCCGTGTGGAGCAGATGG + Intronic
1122367632 14:101203497-101203519 TGTTTGACGTGTGCTGCAGTGGG - Intergenic
1124666238 15:31595193-31595215 TGCCTGGAGTGTGCAGCATGGGG + Intronic
1128285503 15:66433465-66433487 TCTTTGATGTGTGCAGCAGGTGG + Intronic
1129688434 15:77699457-77699479 TGCTTACTGTGTGCAGGTGGTGG - Intronic
1131059441 15:89395582-89395604 TGCCTGCTGTGAGCAGGAGGAGG - Intergenic
1131964884 15:97831127-97831149 GGCTTGCCATGTGCAATAGGAGG - Intergenic
1137293254 16:47066509-47066531 TGCTTGCCCAGAGCAGCAGCAGG + Intergenic
1137334461 16:47533910-47533932 TGCCTGCTCTGTGGAGCAGGAGG + Intronic
1137527651 16:49250221-49250243 TGCTGGCTGAGTGCAGCAGATGG + Intergenic
1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG + Intronic
1142142713 16:88479707-88479729 TGCTGGCCCTGGGTAGCAGGTGG - Intronic
1142226158 16:88878556-88878578 GGCCTGCCGTGTGCACCGGGAGG + Intronic
1142353045 16:89588502-89588524 TCCTGGCCCTGTGTAGCAGGTGG + Intronic
1144512671 17:15890901-15890923 TGCTCTCCATGTGCAGCACGAGG + Intergenic
1145123878 17:20284414-20284436 TGCTGTCCGTGTGCAGGACGAGG + Intronic
1146656758 17:34639068-34639090 TGCCTGCCCTGTGCTGCAGAGGG - Exonic
1147361454 17:39933401-39933423 TGCTGGCCGTGTTCAGAAGCTGG + Intergenic
1149088570 17:52750968-52750990 TGCCTGCTTTGTGGAGCAGGAGG - Intergenic
1151336182 17:73441015-73441037 TCCTTACCGAGTGGAGCAGGTGG + Intronic
1154217952 18:12429286-12429308 CGCTTGCTGTCTGCAGCGGGAGG + Intronic
1157493616 18:48140003-48140025 GGCTTGCCGTGTGAAGCCAGCGG - Intronic
1160088497 18:75803004-75803026 TTCTTCCCGTGTGCACCAGAAGG - Intergenic
1161085860 19:2334583-2334605 TGCTGGCCTTGTCCTGCAGGTGG + Exonic
1161346126 19:3769663-3769685 GGCTGGCCCAGTGCAGCAGGAGG - Exonic
1163641021 19:18462026-18462048 TGCCTGCCTTGGGCAGCAGGTGG - Intronic
925048079 2:789691-789713 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
931794178 2:65693522-65693544 TGCTTGGCGTGGATAGCAGGAGG + Intergenic
933265164 2:80173745-80173767 TGCATGGCGTCTGCATCAGGAGG + Intronic
934734158 2:96680045-96680067 TGCTAGTCGTGTCCCGCAGGTGG + Intergenic
947379745 2:229533602-229533624 TGCTTCCCGTGTGGAGCAGAAGG - Intronic
947703882 2:232258916-232258938 TGCTTGGCGTCTGCAGAAGATGG + Intronic
949026539 2:241768988-241769010 GGCCTGCCCTGTGCAGCCGGTGG - Intergenic
1168893792 20:1310379-1310401 TGGTTGCCCTTTGCTGCAGGAGG + Exonic
1169275134 20:4228669-4228691 TGCTTTCCCTGTGAAACAGGAGG - Intronic
1171503526 20:25613911-25613933 TGGTTGGCGTGTGCTGCAGGGGG - Exonic
1173660317 20:44728843-44728865 TGGTTGCCTTGGGGAGCAGGGGG - Intergenic
1174079116 20:47958427-47958449 GGGTTGCCGTGATCAGCAGGGGG - Intergenic
1175328442 20:58146013-58146035 AGCTTCCTGGGTGCAGCAGGAGG + Intergenic
1176223348 20:63980206-63980228 TGGTTGCCTGGTGCAGCAGCAGG + Intronic
1177396177 21:20538442-20538464 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
1178983988 21:37287668-37287690 TGCCTGCAGTGTGCAGCGTGTGG + Intergenic
1179183177 21:39062277-39062299 TGCCTGCCGTGGGCAGCTGTGGG - Intergenic
1179499647 21:41799887-41799909 TTCTTGTCGTGGGCAGCAGGAGG + Intronic
1181411083 22:22720267-22720289 TTCATGCTGTGTGCACCAGGGGG + Intergenic
1185075569 22:48680363-48680385 TGCATGGCGGGTACAGCAGGAGG - Intronic
1185143471 22:49116850-49116872 TCCGTGCCTTGTGGAGCAGGAGG + Intergenic
953435364 3:42873401-42873423 TAATTGCCGTGTGTGGCAGGTGG - Exonic
957625773 3:82650610-82650632 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
959470176 3:106740347-106740369 TGCATTCCCTGTGCAGCAGCAGG - Intergenic
961532515 3:127547930-127547952 TGCTTGACGTGGGCACCAGGGGG - Intergenic
961921370 3:130429826-130429848 TGCTGGCCCTGTGCTGCTGGGGG + Intronic
962105373 3:132383514-132383536 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
962315783 3:134358659-134358681 TGTTTGGCATGGGCAGCAGGGGG + Exonic
963483239 3:145903819-145903841 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
965541979 3:169880003-169880025 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
966834447 3:184038473-184038495 TGGTGGCCACGTGCAGCAGGTGG - Exonic
966840548 3:184083816-184083838 TGGTGGCCACGTGCAGCAGGTGG - Intergenic
966843238 3:184106192-184106214 TGGTGGCCACGTGCAGCAGGTGG - Exonic
967980783 3:195063977-195063999 TGCTGGGCGTGTCCAGGAGGTGG - Intergenic
968538819 4:1151800-1151822 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
969232501 4:5841422-5841444 TGTGTGCCGTGTTCAGCTGGAGG - Exonic
969548172 4:7845746-7845768 TGGCTGCCCTGTGAAGCAGGGGG - Intronic
981400010 4:144302923-144302945 TCCTTGCAGTCTGCAGCTGGTGG + Intergenic
982360786 4:154516731-154516753 TTCTTGCAGTGTGAAGCAGTGGG - Intergenic
984986835 4:185339432-185339454 TTCTTGCCATGTGCAGCTGAAGG - Exonic
986007151 5:3677723-3677745 TGCTCCCCATGTGCTGCAGGAGG - Intergenic
986284347 5:6348637-6348659 TGCTTGGCGGGGGCTGCAGGAGG + Intergenic
990985639 5:61638703-61638725 TGCTTGCCCTGGGCACCAGTTGG - Intronic
996070452 5:119125349-119125371 TACTTTCCGTAAGCAGCAGGTGG - Intronic
997340714 5:133142425-133142447 TGCATGAAGTGTGCAGCAGAGGG - Intergenic
1001614934 5:173035645-173035667 TGCTTTACGTTTCCAGCAGGAGG + Intergenic
1002293762 5:178216921-178216943 TGCTTGCGGGGTGAGGCAGGAGG + Intronic
1002402507 5:178999008-178999030 TTCTTGGTGTGTGCAGGAGGAGG + Intergenic
1002709994 5:181189621-181189643 GGCTTGCCCTGTGCTGGAGGCGG - Intergenic
1003972245 6:11310815-11310837 TGCTTTCTTTGTGGAGCAGGTGG - Intronic
1004090447 6:12494879-12494901 TGCTTGTTGGCTGCAGCAGGGGG - Intergenic
1004520684 6:16358716-16358738 TGCTTGCTCTGTGGAGCAGGAGG - Intronic
1005860573 6:29896874-29896896 CACATGCCATGTGCAGCAGGAGG + Intergenic
1006442282 6:34060064-34060086 TGCTGGGCCTGTGCAGGAGGCGG + Intronic
1008445704 6:51587437-51587459 TTCTTACCATGTGGAGCAGGAGG + Intergenic
1009479511 6:64139399-64139421 TGATTACCATGTTCAGCAGGTGG + Intronic
1010605193 6:77880703-77880725 TTTTTGAAGTGTGCAGCAGGAGG - Intronic
1012934901 6:105356763-105356785 TCCTAGCTGTGTACAGCAGGAGG + Intronic
1013153288 6:107467722-107467744 TCCTTGCCATGTGCACCTGGAGG - Intergenic
1015239178 6:131004847-131004869 TGCTGGCAGTGGGAAGCAGGAGG - Intronic
1017011863 6:150068780-150068802 TGCTTGCCCTGCAGAGCAGGAGG - Intronic
1019100228 6:169624074-169624096 GGTGTGCCGTGTGCAGCATGTGG + Intronic
1021362809 7:19737321-19737343 TGCTTGCGATGTGAAGCAGCAGG + Intronic
1034983113 7:155490944-155490966 GGCTTGCTGGGTGCTGCAGGGGG - Intronic
1035025219 7:155820589-155820611 TGCTTGCCGCGTGGAGCCTGCGG - Intergenic
1037456936 8:19073173-19073195 TGCTTGGCCTTTGCTGCAGGTGG - Intronic
1038538260 8:28369934-28369956 TGCTGGCTGTGTGGACCAGGTGG - Intronic
1041357394 8:57014676-57014698 TGCCTGCTCTGTGGAGCAGGAGG + Intergenic
1049006306 8:139857759-139857781 TGCTGGCTGTGTGCAGCTGTTGG - Intronic
1050483863 9:6114158-6114180 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053749303 9:41236443-41236465 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054254744 9:62801294-62801316 TGCTCTCCTTCTGCAGCAGGAGG - Intergenic
1054336561 9:63814306-63814328 TGCTTTCCTTCTGTAGCAGGAGG + Intergenic
1056986005 9:91364246-91364268 TGCCTGCTCTGTGGAGCAGGAGG - Intergenic
1060976602 9:127768655-127768677 TGCTGGCCTTGAGCAGCAGCAGG - Intronic
1187093612 X:16123378-16123400 TGATTGAAGTGTCCAGCAGGGGG + Intergenic
1189131857 X:38507396-38507418 TGCCTGCCCTGTGCAGGAAGGGG + Intronic
1189496827 X:41516143-41516165 GCCTTGCTTTGTGCAGCAGGTGG - Intronic
1199634564 X:149803246-149803268 TGCCTGGCGTGTGGACCAGGAGG + Intergenic
1200163760 X:154022332-154022354 TGCATGCCGGGTGCAGCATCTGG - Intronic
1201663772 Y:16426276-16426298 TCCTAGCAGTGTGCAGGAGGTGG + Intergenic