ID: 1141700569

View in Genome Browser
Species Human (GRCh38)
Location 16:85640249-85640271
Sequence GCTCCCTTAACACCGGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141700562_1141700569 -9 Left 1141700562 16:85640235-85640257 CCTGCCCACACTTCGCTCCCTTA 0: 1
1: 0
2: 0
3: 8
4: 180
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700558_1141700569 16 Left 1141700558 16:85640210-85640232 CCCGGTGGCCGGGACTCATGGCT No data
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700559_1141700569 15 Left 1141700559 16:85640211-85640233 CCGGTGGCCGGGACTCATGGCTT 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700556_1141700569 20 Left 1141700556 16:85640206-85640228 CCAGCCCGGTGGCCGGGACTCAT 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700553_1141700569 28 Left 1141700553 16:85640198-85640220 CCTTGTCACCAGCCCGGTGGCCG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700560_1141700569 8 Left 1141700560 16:85640218-85640240 CCGGGACTCATGGCTTCCCTGCC 0: 1
1: 0
2: 5
3: 36
4: 324
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data
1141700561_1141700569 -8 Left 1141700561 16:85640234-85640256 CCCTGCCCACACTTCGCTCCCTT 0: 1
1: 0
2: 1
3: 27
4: 361
Right 1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141700569 Original CRISPR GCTCCCTTAACACCGGCCGG GGG Intronic
No off target data available for this crispr