ID: 1141702696

View in Genome Browser
Species Human (GRCh38)
Location 16:85649846-85649868
Sequence AGGCCCTGATGATGAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141702696_1141702700 4 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702700 16:85649873-85649895 GCCCTCTATCCCCAGAGGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 157
1141702696_1141702699 -1 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702699 16:85649868-85649890 TGTCTGCCCTCTATCCCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 335
1141702696_1141702704 9 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702704 16:85649878-85649900 CTATCCCCAGAGGTGTGGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 228
1141702696_1141702709 30 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702709 16:85649899-85649921 GGGAGCCAGCCTCAGTCCACAGG 0: 1
1: 0
2: 3
3: 24
4: 205
1141702696_1141702702 5 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702702 16:85649874-85649896 CCCTCTATCCCCAGAGGTGTGGG 0: 1
1: 0
2: 1
3: 13
4: 198
1141702696_1141702705 10 Left 1141702696 16:85649846-85649868 CCACCTGCTCATCATCAGGGCCT 0: 1
1: 0
2: 1
3: 22
4: 310
Right 1141702705 16:85649879-85649901 TATCCCCAGAGGTGTGGGAAGGG 0: 1
1: 0
2: 3
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141702696 Original CRISPR AGGCCCTGATGATGAGCAGG TGG (reversed) Intronic