ID: 1141704517

View in Genome Browser
Species Human (GRCh38)
Location 16:85657373-85657395
Sequence CAGAGAGAAGATGCCATGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141704517_1141704524 29 Left 1141704517 16:85657373-85657395 CCAACCATGGCATCTTCTCTCTG 0: 1
1: 0
2: 3
3: 32
4: 434
Right 1141704524 16:85657425-85657447 GATCCAGCGCACCAATGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 66
1141704517_1141704523 26 Left 1141704517 16:85657373-85657395 CCAACCATGGCATCTTCTCTCTG 0: 1
1: 0
2: 3
3: 32
4: 434
Right 1141704523 16:85657422-85657444 GCTGATCCAGCGCACCAATGAGG 0: 1
1: 0
2: 0
3: 5
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141704517 Original CRISPR CAGAGAGAAGATGCCATGGT TGG (reversed) Exonic
901271251 1:7953724-7953746 AAGAAATAAGATGCCATGGAAGG + Intergenic
901763129 1:11483496-11483518 CAGCGAGAAGAGGCCAAGCTGGG + Intronic
901948223 1:12720886-12720908 ACGAGAGCATATGCCATGGTGGG - Exonic
903105324 1:21073559-21073581 CTGTGAGAAGATGCCATTTTAGG - Intronic
904286899 1:29458856-29458878 CAGAGAGCAGATTTCATTGTGGG - Intergenic
904311340 1:29631604-29631626 CAGAGAGGAGATGCCAAGTATGG + Intergenic
904392959 1:30197805-30197827 CAGAGAGGAGATGCCAAGTATGG + Intergenic
907757106 1:57321362-57321384 CAGAGAGAAGGGGCCATGGTGGG - Intronic
909868017 1:80699258-80699280 CGGAGAGAAGCTGCTATGGTGGG + Intergenic
910014335 1:82502662-82502684 CAGAGACAAGAGGGCATGCTGGG + Intergenic
910858079 1:91716263-91716285 CACAGAGAAGACGCCCTGGGAGG + Exonic
911651490 1:100394077-100394099 GAGAGAGAAGATGCAAGGGAGGG - Intronic
911950540 1:104168388-104168410 CAGAGAGAAGAAGTAATGGGAGG + Intergenic
911953981 1:104212784-104212806 CACAGAGGAAATGCCATGTTGGG - Intergenic
912126529 1:106545841-106545863 GAGAGAGAACATGCCGTGTTTGG + Intergenic
912526519 1:110287556-110287578 TAAAAAGAAGATCCCATGGTAGG + Intergenic
912638749 1:111323382-111323404 CAGCAAGAAGATGACATAGTTGG - Intergenic
913328977 1:117651622-117651644 GAGAGAGAAGTTGGCATGGTGGG + Intergenic
916144089 1:161724777-161724799 CACAGAGCAGATGCCATTTTAGG - Intronic
916321053 1:163504706-163504728 CAGCGAGAAGCTGCCATAATTGG - Intergenic
916343672 1:163764214-163764236 CAGTGAGAACATGCAATGTTTGG - Intergenic
916628777 1:166589174-166589196 CAGAGAGAAGTTACCAGGTTGGG - Intergenic
916824459 1:168430577-168430599 GAGTGAGAAGATGCCCTGCTGGG - Intergenic
916835831 1:168543923-168543945 GAGAGAGCAGATGCCAAGGAGGG + Exonic
916838636 1:168576657-168576679 GAGAGAGCAGATGCCAAGGAGGG - Exonic
917057509 1:170999397-170999419 CACAGAGAACATACCATGTTTGG + Intronic
917462075 1:175240727-175240749 CAGAGAGAAAATACAATGTTTGG - Intergenic
918290948 1:183107381-183107403 CAGAGAGAAGGTGATATTGTGGG + Intronic
922029724 1:221786250-221786272 CAGAGAAAAGATGCCAGGGCCGG - Intergenic
922251978 1:223857557-223857579 CAGGGAGAATTTGCCATAGTCGG - Intergenic
923526842 1:234779111-234779133 CAGAGAGCAGGTGCCTTCGTTGG + Intergenic
924568544 1:245218127-245218149 CAGAGGCCAGAGGCCATGGTGGG + Intronic
1063031884 10:2243894-2243916 CAGAGAAAAGAGGCCACTGTTGG + Intergenic
1063065720 10:2606373-2606395 CAGAGAGGAGCTGAGATGGTGGG - Intergenic
1063286879 10:4698301-4698323 CACAGAGAAGAAGCCATGTGAGG - Intergenic
1063421251 10:5914341-5914363 CAGAGCAAAGATGCCCTGGCAGG - Intronic
1063746671 10:8891426-8891448 CAGAGAGAACAGGACATGTTTGG + Intergenic
1064583783 10:16819275-16819297 CATAGAGAAAATGCCCTGGAGGG - Intergenic
1064842268 10:19606860-19606882 TAGAAAGAAGAGGCTATGGTTGG - Intronic
1065463151 10:25990744-25990766 GAGTGAGAAGATGCGATGTTTGG + Intronic
1066010583 10:31190530-31190552 AAGTGAGAACATGCCATGTTTGG + Intergenic
1066499837 10:35981789-35981811 CAGTGAGAACATGCAATGTTTGG + Intergenic
1067035251 10:42910779-42910801 GAGAGAGAATATGCGATGTTTGG + Intergenic
1067335490 10:45359379-45359401 CAGAGCTCAGATGCCATGCTGGG - Intergenic
1067806088 10:49394809-49394831 CACAGAGAAGGAGCCATGCTAGG + Intronic
1068575726 10:58682100-58682122 GAGTGAGAACATGCAATGGTTGG + Intronic
1068750030 10:60582029-60582051 GAGTGAGAATATGCCATGTTTGG - Intronic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1070602959 10:77878479-77878501 CAGACAGCAGATGCTATGGAAGG + Intronic
1070668765 10:78363490-78363512 CATAGAGGAGATGACATGATGGG + Intergenic
1070720996 10:78757033-78757055 CAGAAAGCAGATGCCGTGCTGGG - Intergenic
1071775746 10:88786134-88786156 CAGAGAGGAGGCGCCATGGATGG + Intergenic
1072490506 10:95901178-95901200 GAGTGAGAACATGCCATGTTTGG - Intronic
1073096076 10:100980526-100980548 CTGAGAGCAGATCCCATAGTTGG + Intronic
1073568179 10:104553537-104553559 CAGGGAGAAGATGCCATTTCTGG + Intergenic
1073778209 10:106809310-106809332 GGGACAGAAGATGCCAGGGTTGG + Intronic
1074312369 10:112333195-112333217 AGGAGAGAAGATCCCAGGGTAGG + Intergenic
1074662643 10:115679113-115679135 CAGAGAGTACATGCCATGCAGGG - Intronic
1075708311 10:124516250-124516272 CACAGAGGAGAGGCCATGGGAGG - Intronic
1076158665 10:128223809-128223831 GAGTGAGAACATGCCATGTTTGG + Intergenic
1076242791 10:128922388-128922410 CAGAGAGCAGATGACCTGCTGGG - Intergenic
1076480013 10:130778811-130778833 CAGAGATCAGGTGACATGGTAGG - Intergenic
1077895161 11:6448558-6448580 CAGTGAGGAGATGGGATGGTGGG - Intergenic
1078419624 11:11199036-11199058 GAGTGAGAAGATGCGATGTTTGG + Intergenic
1079392023 11:20030238-20030260 AGGAGAGAAGATGCCATCGTGGG + Intronic
1080138389 11:28885432-28885454 CAGTGAGAACATGCAATGTTTGG - Intergenic
1081847359 11:46250457-46250479 CACAGAGAAGAGGCCATGTGAGG - Intergenic
1083998321 11:66283054-66283076 CAGACAGAAGAGGCCGTGGATGG - Exonic
1084639628 11:70417171-70417193 CAGAGAGAAAATGCCCTCGTGGG - Intronic
1084658289 11:70532033-70532055 CAGAGGGAAGAAGCCCAGGTTGG - Intronic
1084794017 11:71492105-71492127 CAGAAAGAGGATGACATGGTGGG + Intronic
1086200208 11:84193364-84193386 CAGAGAGAAGATGCCTGGATGGG + Intronic
1086535674 11:87842209-87842231 AAGGGAGAAGATGACATGGAAGG + Intergenic
1089135717 11:116247421-116247443 GAGACAGAAGAGGCCCTGGTAGG + Intergenic
1089947927 11:122496573-122496595 GAGTGAGAATATGCCATGTTTGG + Intergenic
1090183681 11:124722197-124722219 CAGGGAGAAGGTGCAAGGGTGGG - Intergenic
1090333049 11:125946041-125946063 CAGGGAGATGGGGCCATGGTGGG + Intergenic
1090974978 11:131672760-131672782 CAGAAAGAAGAGGCCAAGGCTGG - Intronic
1091219211 11:133920434-133920456 CAGAGACAGGATGCCCGGGTAGG + Exonic
1091332913 11:134744603-134744625 CAGAGTGAAGATGCTTTGGAAGG + Intergenic
1091496739 12:979582-979604 CACAGAGAATATGCCATGTGAGG + Intronic
1091938400 12:4451852-4451874 CAGAAAGAAGATGCGATCATGGG - Intergenic
1093786350 12:23195881-23195903 GAGTGAGAAGATGCCATGTTTGG + Intergenic
1093905284 12:24684105-24684127 AAGTGAGAACATGCCATGTTTGG + Intergenic
1093929229 12:24938183-24938205 CAGAGAGCAGATGCTATGCAAGG + Intronic
1094056400 12:26273473-26273495 AAGAGAGAAGATACCATAGAAGG - Intronic
1094510941 12:31096176-31096198 CGGAGAGGAGATGACAAGGTTGG + Intronic
1095393211 12:41733526-41733548 CAGTGAGAACATGCCATGTTTGG + Intergenic
1095976467 12:47943627-47943649 GAGAGAGAAGGGGTCATGGTTGG + Intergenic
1097200735 12:57276532-57276554 CAGTGAGAACATGCGATGTTTGG - Intronic
1097389500 12:58992725-58992747 CAGTGAGAACATGCCATGTTTGG + Intergenic
1097440820 12:59605730-59605752 CATAGAGAAGATGGCATGAGAGG - Intronic
1098119171 12:67217656-67217678 CAGAGAGAAAATGTTAAGGTAGG - Intergenic
1099282145 12:80664079-80664101 CACAGAGAAGAATCCATGGAGGG - Intronic
1099499238 12:83390785-83390807 AAGAGAGGATATGCCATTGTTGG - Intergenic
1100063447 12:90610200-90610222 CACAGAGAAGAGGCCATGTGAGG + Intergenic
1100395208 12:94180114-94180136 GAGAGAGAGGAGGCCATGGCAGG - Intronic
1100933116 12:99632992-99633014 GAGTGAGAACATGCCATGTTTGG + Intronic
1101602874 12:106225620-106225642 CAGATAGAATATGCCATGGCTGG + Intergenic
1102693402 12:114779366-114779388 CAGAGGGAACATGCCAAGTTAGG + Intergenic
1104219347 12:126767097-126767119 CAGAGAGAGGATGGGAAGGTGGG - Intergenic
1105761942 13:23523231-23523253 CAGTGAGAAGGAGCCATGTTTGG - Intergenic
1106200879 13:27536409-27536431 CAGAGAATAGGTTCCATGGTAGG - Intergenic
1107053466 13:36077601-36077623 CACAAAGAAGATGTGATGGTAGG + Intronic
1107390605 13:39959043-39959065 TAGTGAGAATATGCCATGTTTGG + Intergenic
1108099814 13:46942976-46942998 GAGTGAGAACATGCCATGTTTGG - Intergenic
1108454018 13:50595581-50595603 CAGAGAGAAGCTGCCACGAGGGG + Intronic
1108996650 13:56742621-56742643 CAGAGATAAGTTGTAATGGTAGG - Intergenic
1109661176 13:65462542-65462564 GAGAGAGAACATGCTATGTTTGG + Intergenic
1110426097 13:75369119-75369141 AAGACAGAAGATGGCATGCTTGG + Intronic
1110538019 13:76674932-76674954 CAGTGAAAACATGCCATGTTTGG - Intergenic
1111076605 13:83244388-83244410 GAGAGAGAACATGCAATGTTTGG + Intergenic
1112113973 13:96332963-96332985 CACAGAGAAGATGCCATCTATGG + Intronic
1112993390 13:105541980-105542002 GAGAGAGAAGAGGCAATGATTGG - Intergenic
1113195955 13:107806114-107806136 TAGAGAGAAAAAGCAATGGTTGG + Intronic
1113214581 13:108024062-108024084 GAGTGAGAACATGCCATGTTTGG + Intergenic
1114339011 14:21723700-21723722 CAGAGAGAAGATACCGGTGTCGG + Intergenic
1116034604 14:39612713-39612735 CAAAGAGAAGAGGCCAGGTTTGG + Intergenic
1116389223 14:44372499-44372521 CATAGAGAAGATCCAATGTTTGG - Intergenic
1117391653 14:55268303-55268325 GAGAGAGAAGATGAAATGGTGGG + Intergenic
1117502595 14:56368264-56368286 AAGTGAGAACATGCCATGTTTGG + Intergenic
1117994982 14:61470019-61470041 CAGGGAGCAGCTGCCATGGAGGG - Intronic
1118810089 14:69266897-69266919 CAGAGAGAGGAAGCCAAGGCTGG + Intronic
1119227943 14:72958412-72958434 CAATGACAAGATGCCCTGGTTGG - Intronic
1119709151 14:76808969-76808991 TAAAGAGAAGATTCTATGGTAGG - Intronic
1121941518 14:98075371-98075393 CAGATAGGAAATGCCAGGGTGGG + Intergenic
1122403515 14:101481797-101481819 CAGAGAGAAGGTGGGATGGCAGG + Intergenic
1122439150 14:101718310-101718332 CACAGGGAAGAGGCCATGGGAGG + Intergenic
1122542302 14:102505278-102505300 CAGATTGGAGATGCCATGGGGGG - Exonic
1123411638 15:20065933-20065955 CAGAGAGGAGATCCCAGTGTGGG + Intergenic
1123520984 15:21073052-21073074 CAGAGAGGAGATCCCAGTGTGGG + Intergenic
1124242533 15:28041979-28042001 CAGAGAGAAGTCTCCATGTTGGG + Intronic
1124376714 15:29133234-29133256 AGGAGAGAAGATGGGATGGTAGG - Intronic
1124966450 15:34436370-34436392 CAGACACAAGATGCCAAGTTTGG + Intronic
1125518034 15:40333837-40333859 CAGAGAGCAGCAGCCATGGCAGG + Exonic
1125518537 15:40336025-40336047 CAGAGAGGAGCAGCCATGGCAGG + Intronic
1125590465 15:40851568-40851590 CAGAGAAAGGAGGCCATGGCAGG - Intronic
1126520885 15:49592678-49592700 CAGAGATCAAATGCCATGCTGGG + Intronic
1127332475 15:57952407-57952429 CAGAGAGGAGAGGCCAAGCTCGG - Intergenic
1128183238 15:65623380-65623402 CCCAGAGAATATGGCATGGTGGG - Intronic
1128540589 15:68527016-68527038 CAGAGAGAAAAGGCCGTGGGAGG + Intergenic
1128605017 15:69030542-69030564 CAGATAGAAGAGGCCATGAAGGG + Intronic
1128762173 15:70224812-70224834 GGGAGAGAAGATGTCAGGGTGGG - Intergenic
1129266348 15:74395555-74395577 CAGAGAGAAGATCCCAGGTGGGG - Intergenic
1129326686 15:74803541-74803563 GAGAGAGAAAAAGCAATGGTGGG + Intergenic
1129516753 15:76161790-76161812 CAGAGACAAGAGGCCAGGGAGGG - Intronic
1129534788 15:76304197-76304219 AAGAGAGAACATTCCATGTTTGG - Intronic
1130046280 15:80447629-80447651 CAGAGAAAAGATGCCAGATTTGG + Intronic
1131973068 15:97911855-97911877 CAGAGAGAAGATGCCCTCCCTGG - Intergenic
1132611890 16:821232-821254 CTGAGAGAAGAGGCCCTGGGAGG + Intergenic
1132736608 16:1389076-1389098 CAGACAGCAGGTGGCATGGTGGG - Intronic
1132855968 16:2044661-2044683 CAGACAGATGATGCCACGCTGGG - Exonic
1133050300 16:3113603-3113625 CAAAGAGAAGGTGGCATGCTGGG + Intronic
1135481095 16:22821182-22821204 AGGAGATAAGATGCGATGGTGGG + Intronic
1138063808 16:53919742-53919764 GAGTGAGAACATGCGATGGTTGG - Intronic
1138547158 16:57726785-57726807 CACAGAGAGGCTGCCATGATCGG - Intronic
1138942491 16:61807230-61807252 GAGTGAGAATATGCCATGTTTGG - Intronic
1139210108 16:65068444-65068466 GAGAGAGATGATGACATGATTGG + Intronic
1140942227 16:79732961-79732983 CTGAGAAAAGAAGCCATGTTGGG + Intergenic
1141568618 16:84920639-84920661 CAGGGACCAGATGACATGGTCGG - Intronic
1141704517 16:85657373-85657395 CAGAGAGAAGATGCCATGGTTGG - Exonic
1141896785 16:86963467-86963489 CAGAAAGCAGATGCCACAGTGGG - Intergenic
1142248724 16:88981387-88981409 CACGGAGAAGGTGCCATGGCCGG + Intergenic
1142756487 17:2019313-2019335 CAGAGAGGAGATGACAGGGAGGG - Intronic
1143781024 17:9229843-9229865 CATAGAGAAGAGGCAGTGGTGGG + Intronic
1144705857 17:17367416-17367438 CACAGAGCAGATGACATGCTGGG + Intergenic
1145004615 17:19330282-19330304 AAGAGAGAAGTTGCCATGTGTGG - Intronic
1145841385 17:27998073-27998095 AAAAGAGCAGAGGCCATGGTCGG - Intergenic
1147028643 17:37611224-37611246 CAGACAGCAGATACAATGGTGGG + Exonic
1147457693 17:40548634-40548656 GAGAGATGAGATGCCATGGAAGG - Intergenic
1147653274 17:42073876-42073898 CAGAGAGGAGGCCCCATGGTGGG + Intergenic
1148355393 17:46972259-46972281 CAGGGAGAAGATGGGATGGAAGG - Intronic
1149290421 17:55213107-55213129 CAGAGAGTAGATGCGGTGGTTGG + Intergenic
1150027364 17:61690992-61691014 GAGTGAGAACATGCCATGTTTGG - Intronic
1151407667 17:73899956-73899978 CAGAGTGTAGAGGCCATGGAAGG - Intergenic
1151715412 17:75828700-75828722 CAGAGAGGTGATGCCAGGGTCGG - Intronic
1152684147 17:81685580-81685602 GAGAGAGAAAATGCCATGAAAGG - Intronic
1203163452 17_GL000205v2_random:72652-72674 GAGTGAGAACATGCCATGTTTGG + Intergenic
1153378558 18:4410064-4410086 CAGTGAGAACATACCATGTTTGG - Intronic
1153529230 18:6027268-6027290 GAGTGAGAACATGCCATGTTTGG + Intronic
1153689476 18:7577437-7577459 CAGAAAGAAGATTCCATGACAGG + Intronic
1156554641 18:38053406-38053428 AAGACAGAACATGCCATGTTAGG + Intergenic
1156765027 18:40642322-40642344 AAGAGAGAAGAGTCCAAGGTTGG - Intergenic
1157304831 18:46509338-46509360 CAGAGAGAGGCTGCCATGGTGGG - Intronic
1157532643 18:48434678-48434700 GAGTGAGAACATGCCATGTTTGG - Intergenic
1158548962 18:58418733-58418755 CAGTCAGAAGCTGCCTTGGTTGG + Intergenic
1159836119 18:73337558-73337580 GAGAGTGAAGATGCCAAAGTTGG + Intergenic
1160071849 18:75635887-75635909 AAGAAAGAAAATGCAATGGTTGG - Intergenic
1161273867 19:3404731-3404753 CAGAGGGATGATGTCATGGGCGG + Intronic
1161517454 19:4704275-4704297 CCGAGAGTAGACCCCATGGTGGG + Exonic
1162563960 19:11435000-11435022 CACAGAGGAGATGTCATGATGGG + Exonic
1162970254 19:14176874-14176896 CAGAGCGAAGGTGTCATGGGAGG - Intronic
1163186144 19:15640936-15640958 CTGACAGAAGGTGCCAGGGTGGG + Exonic
1164390647 19:27817319-27817341 GAGTGAGAACATGCCATGTTTGG + Intergenic
1165145181 19:33725976-33725998 CAGAGAGAAGCTTTCAGGGTGGG + Intronic
1165955688 19:39500607-39500629 GAAAGAGAAGGTGCCCTGGTTGG - Exonic
1166645355 19:44527582-44527604 CAGAGGGAAGGGGCCATGGCAGG - Intronic
1167106317 19:47431878-47431900 TAGAGAGAAGGTGGCAGGGTGGG - Intronic
1168579895 19:57546482-57546504 CATAGAGAAAATCCCAAGGTGGG + Exonic
925802348 2:7613922-7613944 CTGAGAGAGGAAGCCATTGTAGG - Intergenic
926697909 2:15783674-15783696 CAGGGAGAAAACGCCATGGCTGG - Intergenic
926702050 2:15810318-15810340 CTGAGAGAAGAGGCCAAGGGAGG - Intergenic
927091878 2:19718749-19718771 CAGAGACACGAGGCCAAGGTGGG - Intergenic
927341448 2:21988265-21988287 CAGAGTGAAGGTGCCAGGGTTGG - Intergenic
927351815 2:22125106-22125128 CAGAGAGGATAAGCCATGGGAGG - Intergenic
928053498 2:28026490-28026512 GAGTGAGAATATGCCATGTTTGG - Intronic
928167314 2:28980592-28980614 CAGAGAGAGGATGCCAGCCTGGG + Intronic
928538640 2:32263657-32263679 CAGAGAGAAAAGGCCAAGGAGGG + Intronic
928676081 2:33653246-33653268 CAGTGAGAAGATACCCTGCTGGG + Intergenic
929465859 2:42143162-42143184 CAGAGAGGAGCAGCCATGGCGGG - Intergenic
929785790 2:44990174-44990196 CAGAAATAAGATACCCTGGTAGG - Intergenic
931252357 2:60544550-60544572 AAGAAAGAAAATGCCATGTTTGG + Intronic
932596208 2:73095108-73095130 CAGAGAGATGAAGTCAAGGTGGG - Intronic
932825969 2:74940487-74940509 CAGAGAGATAATGCCAAGATCGG + Intergenic
933182873 2:79246903-79246925 GAGAGAGAAGAGTCCATAGTTGG + Intronic
933569478 2:83992648-83992670 GAGAGAAAATTTGCCATGGTGGG + Intergenic
933748639 2:85588864-85588886 CACAGAGAGGGTGCCATGGTGGG - Intronic
935175447 2:100644760-100644782 CAGAGAGATGAAGTCATTGTTGG + Intergenic
935458577 2:103300437-103300459 GAGTGAGAATATGCCATGTTCGG + Intergenic
936098844 2:109556929-109556951 GAGTGAGAACATGCCATGTTTGG - Intronic
937053395 2:118910581-118910603 CAGAGGAAAAGTGCCATGGTAGG + Intergenic
937435225 2:121874506-121874528 CAGAGAAAAGGTAGCATGGTGGG + Intergenic
937898509 2:126997317-126997339 GAGTGAGAACATGCCATGTTTGG - Intergenic
938031407 2:127997591-127997613 CAAAGAGAAGTTGGCATGATAGG + Intronic
938266031 2:129928971-129928993 CAGAAAGCAGCAGCCATGGTGGG + Intergenic
938738059 2:134204497-134204519 CAGAAACAAGATGTCATGGAAGG + Intronic
938797730 2:134732209-134732231 CAGTGAGAACATACCATGTTTGG + Intergenic
939791605 2:146585155-146585177 CAGAGAGGAAAGGCCATGGGAGG - Intergenic
940619482 2:156093050-156093072 CAGAGAGAACATTCAGTGGTTGG - Intergenic
940955689 2:159724914-159724936 GAGTGAGAACATGCCATGTTTGG + Intronic
941503901 2:166315784-166315806 CACAAAGAAGATGCAATGATGGG + Intronic
941758306 2:169212678-169212700 CAGTGAGAACATGCGATGTTTGG - Intronic
941890504 2:170576211-170576233 CAGAGAGAAGATGTGATTGTTGG + Intronic
941939414 2:171018199-171018221 CACAGAGAAAAGGCCATGTTAGG + Intronic
942732434 2:179075029-179075051 CAGAGGGCAGAGGCCATGGCAGG - Intergenic
944337172 2:198549108-198549130 CAGAGAGAAGATGCCCTTCGAGG - Intronic
944346812 2:198677018-198677040 GAGTGAGAACATGCCATGTTTGG + Intergenic
944656469 2:201880967-201880989 GAGAGAGAAGCAGCCAGGGTTGG + Intronic
945222908 2:207502968-207502990 CACAGAGAAGAGGCCATGTGAGG - Intergenic
946942947 2:224789157-224789179 CATAGAGAACATGCCTTGGGAGG + Exonic
947039339 2:225897770-225897792 CACACAGAAGATGCCGTGCTGGG + Intergenic
947239115 2:227975137-227975159 CAGAGAGATGATACCAAGGAAGG - Intergenic
947712519 2:232324136-232324158 CATGGAGAAGAGGCCATGGTTGG + Intronic
948156269 2:235785101-235785123 GGGAGAGAAGATGTCTTGGTTGG - Intronic
948199112 2:236116832-236116854 CAGTGAGAACATGCGATGTTTGG + Intronic
948713020 2:239836906-239836928 CAGAGAGGAGATGCTGGGGTGGG - Intergenic
948854580 2:240724220-240724242 CAGAGAAAAGATGCATTGGCTGG + Intronic
1169002126 20:2175753-2175775 CAGTGAGAAGATACAATGTTTGG + Intronic
1169033477 20:2431085-2431107 CAGAGAGAAGTTGCCAGGGATGG + Intronic
1169419554 20:5449023-5449045 CAGAGGGAGGAGGCCTTGGTGGG + Intergenic
1169721946 20:8687568-8687590 CAGAGAGAACATACGATGTTTGG + Intronic
1170844948 20:19954483-19954505 CAGAGCGAAGCTGCCTTGGATGG + Intronic
1171266081 20:23773239-23773261 CAGAGGGAAGAAGCCAGGGCAGG + Intergenic
1173083474 20:39891997-39892019 AAGGGAGCAGAGGCCATGGTAGG - Intergenic
1174050053 20:47761257-47761279 CAGACAGAAGATGGCAGGGATGG + Intronic
1174341208 20:49897004-49897026 CAAAGAAAAGATACCCTGGTTGG + Intergenic
1174596235 20:51686124-51686146 GAGTGAGAACATGCCATGTTTGG - Intronic
1175285654 20:57834985-57835007 CAGAGGGAAGAAGCCATGTGAGG - Intergenic
1175415217 20:58796470-58796492 GAGAGAGAACGAGCCATGGTGGG - Intergenic
1177322380 21:19539917-19539939 AAGTGAGAACATGCCATGTTTGG - Intergenic
1177480319 21:21677915-21677937 CAGAGAGAACATGCAGTGTTTGG + Intergenic
1177772357 21:25530764-25530786 GAGTGAGAACATGCCATGTTTGG + Intergenic
1178787632 21:35668225-35668247 CAAAGAGAAGAGGCCATGTGAGG - Intronic
1178849277 21:36199669-36199691 GAGTGAGAACATGCCATGTTTGG + Intronic
1179561143 21:42217010-42217032 GAGAGGGAAGATGCTATGCTGGG - Intronic
1180490101 22:15836779-15836801 ACGATAGAAGATGCCATAGTTGG - Intergenic
1181432684 22:22892802-22892824 CAGAGAGCAGAACCCAGGGTGGG + Intronic
1181634960 22:24170205-24170227 CCCAGAGAAGATGCCACTGTAGG + Intronic
1182642605 22:31780534-31780556 AAGAGAGAAGGTGGCATGTTGGG - Intronic
1184045760 22:41971438-41971460 CAGAGAGAAGAGGCCAGGCAGGG - Intergenic
1184196414 22:42932158-42932180 CAGAGAGAAGATCCTGTGCTGGG - Intronic
1184469881 22:44690397-44690419 GAGAGAAAGGATTCCATGGTGGG + Intronic
1184915685 22:47567397-47567419 CAGAGGGCAGATGCCTGGGTTGG - Intergenic
1185423186 22:50746697-50746719 CAGAGAGAAGGTGCCATGGCAGG + Intergenic
949380798 3:3443659-3443681 CAGAGAGCAGAGGGCATTGTGGG + Intergenic
949934739 3:9107971-9107993 CAGAGAGAGGATGGAATTGTGGG + Intronic
950261380 3:11545139-11545161 CAGAGAGAGGGTGCCGGGGTGGG + Intronic
950373104 3:12547749-12547771 CACAGAGAAGGTGTCATGGCAGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950444625 3:13029369-13029391 CAGATAGAACATGGCAGGGTGGG + Intronic
951127779 3:19004127-19004149 GAGTGAGAACATGCCATGTTTGG + Intergenic
951852476 3:27157088-27157110 CAGTGAGAAGATACAATGTTTGG - Intronic
952004237 3:28823839-28823861 CAGAGATCAGAGGCCATCGTGGG - Intergenic
952007887 3:28863324-28863346 CACAGAGAGGTTGGCATGGTGGG - Intergenic
953544711 3:43855945-43855967 CAGGGAGAAGAAGCCTTGCTGGG - Intergenic
953553604 3:43924260-43924282 AAGAGAGAAGAGGCCAAGGACGG - Intergenic
954211601 3:49100651-49100673 CAGAAAACAGATGCCATTGTTGG + Exonic
954592961 3:51799703-51799725 CAGAGGGAAGATGGCGTGATTGG + Intergenic
956014589 3:64868230-64868252 GAAAGTGAAGATCCCATGGTAGG + Intergenic
957579383 3:82051203-82051225 CAGAGACAAGATCACATGGCTGG - Intergenic
957600784 3:82333364-82333386 GAGTGAGAATATGCCATGTTTGG + Intergenic
960643042 3:119847045-119847067 GAGTGAGAACATGCCATGTTTGG - Intronic
962083939 3:132170871-132170893 CAGTCAGAAGATGCCAAGGTTGG - Intronic
962673194 3:137730152-137730174 AAGAGAGAACATGCAATGTTTGG + Intergenic
963612284 3:147485180-147485202 GAGTGAGAACATGCCATGTTTGG + Intronic
963706939 3:148699028-148699050 CAAAGAGAAGAGGCCCAGGTGGG - Intronic
964600723 3:158497786-158497808 CAGTGAGAAGATACAATGTTTGG + Intronic
965371070 3:167863259-167863281 CAGAGAGAAAATGGTCTGGTAGG + Intergenic
966595004 3:181717911-181717933 AAGAGATAAGCTGCAATGGTGGG + Intergenic
966607709 3:181838185-181838207 CAGAGAAATGAAGCAATGGTTGG + Intergenic
967741115 3:193003050-193003072 CAGTGAGAAGATACGATGTTTGG + Intergenic
968266600 3:197367798-197367820 CAGAGAGATGAAGCCTGGGTGGG + Intergenic
968577080 4:1372336-1372358 CGGAGAGAAAGTGCCATGGATGG - Intronic
971288573 4:25313484-25313506 CAGAAAGAAAATGCTATTGTCGG - Intronic
971579551 4:28317469-28317491 CACAGAGGAGAAGCCATGCTGGG - Intergenic
972192268 4:36609430-36609452 CATAGATAAGAAGGCATGGTAGG + Intergenic
972802041 4:42486691-42486713 CAGACTGAATATCCCATGGTGGG + Intronic
973532972 4:51851453-51851475 CAGCGACAACATGGCATGGTGGG + Intronic
973680857 4:53317765-53317787 CAGAGAGAAGAAGCCCTCCTAGG - Intronic
973700099 4:53528766-53528788 CAGGGAGATGGTGCCAGGGTAGG - Intronic
973833145 4:54781993-54782015 CAGTGATAAGATGCCCTGGAGGG - Intergenic
973838018 4:54830666-54830688 GAGTGAGAACATGCCATGTTTGG - Intergenic
973848207 4:54934716-54934738 CAGAGAGCAGATTCAAAGGTAGG - Intergenic
974255686 4:59451360-59451382 GAGTGAGAACATGCCATGTTTGG + Intergenic
974667865 4:64988596-64988618 GAGAGAGAAGAGAACATGGTAGG - Intergenic
975357815 4:73428715-73428737 CAGACAACAGATGCCATGTTTGG + Intergenic
976100812 4:81561139-81561161 GAGTGAGAACATGCCATGTTTGG + Intronic
976283819 4:83351424-83351446 GAGTGAGAACATGCCATGTTTGG + Intergenic
976690668 4:87864097-87864119 CAGAGAGGGGCTCCCATGGTGGG + Intergenic
976944511 4:90747885-90747907 GAGTGAGAATATGCCATGTTTGG + Intronic
977462511 4:97342775-97342797 GAGAGAGAACATGCAATGTTTGG - Intronic
978050745 4:104196758-104196780 GAGTGAGAACATGCGATGGTTGG + Intergenic
978108798 4:104936289-104936311 GAGTGAGAACATGCCATGTTTGG - Intergenic
978266825 4:106837175-106837197 CACAGAGAAGAAGCCATGAGAGG + Intergenic
978338269 4:107693386-107693408 CTGAGCAAAGAAGCCATGGTAGG + Intronic
978947023 4:114512064-114512086 CAGAGAGAGAATGCACTGGTTGG + Intergenic
979677002 4:123420358-123420380 CAGAGAGAAGTTGCTTTAGTAGG + Intergenic
980626679 4:135381941-135381963 CAGAGAGGAGATGGGAAGGTGGG - Intergenic
980933727 4:139206478-139206500 GAGAGAGAAGATGGCATGAAGGG - Intergenic
982135200 4:152268583-152268605 CAGTGAGAAGGTGCTATGGGTGG + Intergenic
982137272 4:152283508-152283530 AAGTGAGAAGATGCCGTGTTTGG + Intergenic
983714431 4:170761064-170761086 GAGAGAGATGTTGCCATGGCTGG - Intergenic
984388980 4:179102749-179102771 CAGAGCCAAGAGGCCATGGCGGG + Intergenic
984646214 4:182223109-182223131 AAGAGAGAAGAAACTATGGTAGG + Intronic
984790995 4:183614927-183614949 CAGAGAGAAGATGTAAGGATGGG + Intergenic
987704016 5:21440691-21440713 CAGTGAGAACATGCGATGTTTGG + Intergenic
988062127 5:26184973-26184995 CAGTGAGAACATGCAATGTTCGG + Intergenic
988385640 5:30561154-30561176 CAGTGAGAACATGCAATGTTTGG - Intergenic
988951203 5:36262804-36262826 AAGAGAGCATGTGCCATGGTTGG + Intronic
989072028 5:37521571-37521593 GAGTGAGAAGATGCGATGTTTGG + Intronic
989947330 5:50254515-50254537 GAGCGAGAACATGCCATGTTTGG - Intergenic
990020692 5:51123912-51123934 CTGAGAGAACATGGCATGATTGG + Intergenic
990889593 5:60633511-60633533 CCGTGAGAACATGCCAGGGTTGG + Intronic
993965284 5:94352833-94352855 CAGGGAGAACATACCATGTTTGG - Intronic
995349705 5:111160898-111160920 CAGTGAGAACATGCGATGTTTGG + Intergenic
996513222 5:124340989-124341011 CAGAGAGAAAAAGACATGTTAGG + Intergenic
997159778 5:131595264-131595286 CAGAGAGAGAATGCGATGGGGGG - Intronic
997294506 5:132761277-132761299 CAGAGAAAAGAGGCCAAGGATGG + Intronic
998452315 5:142244513-142244535 CACAGAGAAGAAGCCATGTGAGG - Intergenic
998773614 5:145573582-145573604 GAGTGAGAACATGCCATGTTTGG + Intronic
999027539 5:148252333-148252355 GAGTGAGAATATGCCATGTTTGG + Intergenic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
1002468014 5:179417451-179417473 CAGAGGGCAGGTGCCATGGCAGG - Intergenic
1003357646 6:5389313-5389335 AAGAGAGAAGATGGCAAGGGAGG - Intronic
1003936008 6:10976176-10976198 CAGAGATGAGAGGCTATGGTAGG + Intronic
1004531313 6:16457911-16457933 GAGAGAGAAGGTCCCATGTTGGG - Intronic
1004533527 6:16477236-16477258 CACAGAGAAGTGGCCATGGAGGG + Intronic
1005143179 6:22657736-22657758 CTGAGAGAAGCTGCCATCCTTGG + Intergenic
1005701662 6:28407459-28407481 AAGAGAGAAGCTGCCATGCAGGG + Intergenic
1006437961 6:34036148-34036170 CAGCGAGCAGGTGCCAAGGTCGG + Exonic
1006878299 6:37317279-37317301 CAGACAGAAGGTGCCATAGCAGG + Intronic
1007173981 6:39883926-39883948 TAGGGAGAAGATCCCATGGTTGG - Intronic
1007468939 6:42075558-42075580 CAGACAGAGGATGCCATGACCGG - Intronic
1007479328 6:42139951-42139973 CAGAGACAGGATGCCAAGGCAGG + Intronic
1008373128 6:50759232-50759254 GAGAGACAATATGGCATGGTGGG + Intronic
1009400918 6:63254507-63254529 CAGAAAGAAGGTCCCAGGGTAGG - Intergenic
1009537086 6:64901148-64901170 AAGAGAGAACATGCAGTGGTTGG - Intronic
1009787955 6:68362605-68362627 GAGTGAGAAGATGCAGTGGTTGG + Intergenic
1010282200 6:74035190-74035212 CAGAGCTCAGATGCCATGCTGGG + Intergenic
1010605113 6:77879738-77879760 CAAGGAGAACATGCCATGTTAGG + Intronic
1010642236 6:78342710-78342732 TAGAGAGATGATGCCATTTTGGG - Intergenic
1010663622 6:78600070-78600092 CAGAGAAAAGAGGACATGGAGGG + Intergenic
1011881262 6:92030859-92030881 GAGAGAGAACATGCCGTGTTTGG - Intergenic
1012880109 6:104777008-104777030 CATGGAGAAGAAGGCATGGTGGG - Exonic
1012953004 6:105539045-105539067 GAGTGAGAACATGCCATGGTTGG - Intergenic
1013141944 6:107345922-107345944 CAGAGAAAAGATTCCATGACTGG + Intronic
1013481951 6:110560739-110560761 CACAGAGAAGGTGAAATGGTTGG + Intergenic
1014326448 6:120001940-120001962 CAGATAGAAACTGCCATGTTTGG + Intergenic
1015207284 6:130654499-130654521 CAGAGAAAGGATGTCATGGAAGG - Intergenic
1015566743 6:134580745-134580767 GAGTGAGAACATGCCATGTTTGG - Intergenic
1015637432 6:135291470-135291492 CACAGAGAAGAGGCCATGTGAGG + Intronic
1017125489 6:151060527-151060549 CAGGGAGCAGATGCCATGGGGGG + Intronic
1017349775 6:153426615-153426637 CATAGAGAAAAGGCCATGGGAGG + Intergenic
1018067161 6:160132206-160132228 CAGAGAGAAGGAGACATGGAGGG - Intronic
1018947231 6:168356391-168356413 CAGAAAGAAGGTGCCAAGGGAGG - Intergenic
1019446680 7:1074872-1074894 CAGAGAGCAGAGGGCAAGGTGGG + Intronic
1019891434 7:3950355-3950377 CAGATAGAAGATGGGATGATCGG - Intronic
1021839242 7:24709162-24709184 AAGAGAGAAGCTGTCCTGGTCGG + Intronic
1022719259 7:32928112-32928134 CGGAGAGAAGCTACCATGGGAGG - Intergenic
1022876646 7:34539926-34539948 GAGTGAGAACATGCCATGTTTGG + Intergenic
1023325875 7:39055301-39055323 ATGAGAAAAGATGCAATGGTGGG + Intronic
1024210292 7:47197479-47197501 CACAGAGAAGAGGCCATGTCAGG + Intergenic
1026580371 7:71611177-71611199 CAGCTGGAAGATCCCATGGTGGG - Intronic
1028437699 7:90823499-90823521 CAGAGAGAAGAAGCCCTGTTGGG + Intronic
1028992953 7:97069513-97069535 CAGTGAGAAGATACAATGTTTGG + Intergenic
1029133530 7:98351573-98351595 GAGAGAGAGGATGTGATGGTTGG + Intronic
1030628947 7:111874139-111874161 GAAAGAGAAGATGCCAGGGAGGG - Intronic
1030969121 7:116032589-116032611 AAGAGAGAAGATGCAATATTTGG - Intronic
1031191052 7:118551701-118551723 GAGCGAGAACATGCCATGTTTGG + Intergenic
1032874785 7:136026603-136026625 CAGAGAGAAGCTGCCATGAGAGG + Intergenic
1034060176 7:148080124-148080146 CAGAGTAAAGATGACATAGTGGG + Intronic
1034489333 7:151385032-151385054 CAGAGAGGAGAAGCCAGGCTGGG + Intronic
1035132638 7:156669731-156669753 CAGGGAGAAGGGGCCATGGCTGG + Intronic
1037005278 8:13770864-13770886 AAGAGAAAAGATGACAAGGTGGG + Intergenic
1037681923 8:21104722-21104744 CAAAGAGTAGAGGACATGGTGGG + Intergenic
1037739004 8:21590392-21590414 TAGAAAGAAGATACCTTGGTAGG - Intergenic
1038505852 8:28084430-28084452 CAGAGAAAAGATGCTGTGGAAGG - Intergenic
1038998392 8:32951769-32951791 GAGAGAGCATATGCCATGCTGGG - Intergenic
1039350933 8:36762700-36762722 CACAGAGAAGATCCCCTTGTTGG + Intergenic
1039800752 8:40952445-40952467 CAGATAGAAGAACCCATGGTTGG + Intergenic
1041564197 8:59258051-59258073 GAGTGAGAACATGCCATGTTTGG + Intergenic
1041627276 8:60044930-60044952 CACAGAGAAGAGGCCATGTGAGG + Intergenic
1042249833 8:66744890-66744912 CAGACAAAAAATGCCAAGGTTGG - Intronic
1042812356 8:72840143-72840165 GAGTGAGAACATGCCATGTTTGG + Intronic
1044874061 8:96646811-96646833 CAGAGACAAAATGCTATGGGAGG - Intronic
1045586089 8:103538863-103538885 CAGTGAGAACATACCATGTTTGG + Intronic
1046388782 8:113540605-113540627 CAGAGAGAACTTGCCATGTGGGG - Intergenic
1046427597 8:114075443-114075465 AACAGAGAGGATGCCATTGTGGG - Intergenic
1047032836 8:120901934-120901956 CAGTGAGAACATGCAATGTTTGG - Intergenic
1047119640 8:121886611-121886633 CAGAGAGAAGATGCAGTATTTGG + Intergenic
1047203590 8:122785812-122785834 CAAAGAGATGATGCCAGGCTTGG + Intronic
1047332517 8:123904648-123904670 CAGAGGGTAGATGCCAAGTTAGG + Intronic
1047495273 8:125404614-125404636 CATAGAGAAGAAGGCATGGCTGG + Intergenic
1048166651 8:132067497-132067519 CAGAGATAGGATGTCAAGGTTGG + Intronic
1048518876 8:135135858-135135880 CAGAGAGAGCAGGCCATGCTGGG + Intergenic
1048744732 8:137601359-137601381 GAGTGAGAATATGCCATGTTTGG - Intergenic
1049106803 8:140619109-140619131 CAGACAGAGGCTGCCATGGAAGG + Intronic
1051363167 9:16300337-16300359 CAGTGAGAACATGCAATGTTTGG - Intergenic
1055063986 9:72100357-72100379 GAGTGAGAACATGCCATGTTTGG - Intergenic
1055183531 9:73420374-73420396 CAGAGAAAAGATACAATGGTAGG + Intergenic
1055709387 9:79043220-79043242 CAGAGAGAACACGCCCTAGTGGG + Intergenic
1056203669 9:84300285-84300307 CAGAGAGGAGATAGCATGTTTGG + Intronic
1058212099 9:102181776-102181798 CAGAGAAATGGAGCCATGGTTGG - Intergenic
1058529397 9:105890657-105890679 CAGAGAGGAGAGGCCATGCCAGG + Intergenic
1058529806 9:105894351-105894373 AAGTGAGAACATGCCATGTTTGG + Intergenic
1058631043 9:106986847-106986869 CAGTGAGAACATACCATGTTTGG + Intronic
1059085916 9:111302847-111302869 CAGAGAGAAAATGCCATGTGAGG - Intergenic
1059328864 9:113522639-113522661 CAGAGACCAGCTGCCATGGAGGG + Intronic
1061296784 9:129681221-129681243 CAGAGAGCAGGTTCCCTGGTTGG + Intronic
1186365301 X:8886327-8886349 CTGAGAGATGATGCCCTGGTTGG - Intergenic
1186379486 X:9042853-9042875 GAGTGAGAACATGCCATGTTTGG + Intronic
1186445174 X:9621061-9621083 GAGAGACGAGATGCCATGGTTGG + Intronic
1186690112 X:11966358-11966380 CAGCAAGAAGATGCCATCTTTGG + Intergenic
1186815891 X:13237741-13237763 CAGAGAGAAGATGAACTGATAGG + Intergenic
1186861852 X:13680545-13680567 CAGAGGGAAGATGACATGGACGG + Intronic
1188522094 X:31050129-31050151 CAGCAATAAGAGGCCATGGTAGG - Intergenic
1188635229 X:32421688-32421710 CGATGAGAAGATGCCATTGTGGG - Intronic
1188698683 X:33231784-33231806 GAGATATAAGCTGCCATGGTGGG + Intronic
1188890025 X:35598924-35598946 GAGTGAGAAGATGCAATGTTTGG - Intergenic
1189448908 X:41108786-41108808 CAGAGTCAAGATTCCATGGCAGG - Intronic
1190584511 X:51925514-51925536 CTGAGAGAAGATGCGATTGAGGG + Intergenic
1191881009 X:65843725-65843747 CACAAAGCAGAGGCCATGGTAGG - Intergenic
1192799744 X:74454485-74454507 GAGTGAGAACATGCCATGTTTGG - Intronic
1193435431 X:81469698-81469720 GAGTGAGAACATGCCATGTTTGG + Intergenic
1194437041 X:93879600-93879622 AAGAGAGAATATGCAATGTTTGG - Intergenic
1194508539 X:94763816-94763838 GAGTGAGAACATGCGATGGTTGG + Intergenic
1194601791 X:95930444-95930466 GAGTGAGAACATACCATGGTTGG - Intergenic
1195867356 X:109447533-109447555 GAGTGAGAACATGCCATGTTTGG - Intronic
1195928077 X:110046416-110046438 CAGAGAAGAGAGGCCAAGGTGGG - Intronic
1196535479 X:116838591-116838613 AAGAGAGAAGATGGCAAAGTGGG - Intergenic
1197937898 X:131758940-131758962 AAGAGATAAGATATCATGGTCGG - Intergenic
1198496317 X:137196957-137196979 CAGGGAGTCAATGCCATGGTAGG + Intergenic
1198510558 X:137346635-137346657 CAGTGAGAACATACCATGTTTGG + Intergenic
1200276344 X:154736676-154736698 CAGGGAGAATAAGCCAGGGTTGG + Intronic
1200883419 Y:8244442-8244464 GAGTGAGAACATGCCATGGTTGG - Intergenic
1201628966 Y:16047888-16047910 GAGTGAGAACATGCCATGTTTGG - Intergenic
1201699476 Y:16864663-16864685 GAGTGAGAACATGCCATGTTTGG - Intergenic
1201751763 Y:17439923-17439945 GAGTGAGAACATGCCATGTTTGG + Intergenic
1201988465 Y:19995451-19995473 AAGACACAAGATGCCTTGGTGGG - Intergenic
1202137981 Y:21687058-21687080 AGGAGAGAAGGTGCCATGGCCGG - Intergenic