ID: 1141705410

View in Genome Browser
Species Human (GRCh38)
Location 16:85661851-85661873
Sequence AGGCAAAAAGCAGGAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 616}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141705410_1141705419 1 Left 1141705410 16:85661851-85661873 CCGTCCACTCCTGCTTTTTGCCT 0: 1
1: 0
2: 5
3: 44
4: 616
Right 1141705419 16:85661875-85661897 GGGTAGTCCCAGGCCCCAGGTGG 0: 1
1: 0
2: 2
3: 35
4: 347
1141705410_1141705418 -2 Left 1141705410 16:85661851-85661873 CCGTCCACTCCTGCTTTTTGCCT 0: 1
1: 0
2: 5
3: 44
4: 616
Right 1141705418 16:85661872-85661894 CTGGGGTAGTCCCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 55
4: 368
1141705410_1141705422 13 Left 1141705410 16:85661851-85661873 CCGTCCACTCCTGCTTTTTGCCT 0: 1
1: 0
2: 5
3: 44
4: 616
Right 1141705422 16:85661887-85661909 GCCCCAGGTGGCAAGTGCACTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1141705410_1141705416 -9 Left 1141705410 16:85661851-85661873 CCGTCCACTCCTGCTTTTTGCCT 0: 1
1: 0
2: 5
3: 44
4: 616
Right 1141705416 16:85661865-85661887 TTTTTGCCTGGGGTAGTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141705410 Original CRISPR AGGCAAAAAGCAGGAGTGGA CGG (reversed) Intronic
900398846 1:2464626-2464648 ATGGAGAAAGCAGGAATGGAAGG + Intronic
900592264 1:3465377-3465399 AGGCAGACAGGAGGAGAGGACGG + Intronic
901238087 1:7678287-7678309 AGCCAAGAAGCTGGAGTTGAGGG - Intronic
902472234 1:16657017-16657039 AGGGAAAGAGCAGGAATGGGTGG + Intergenic
902486569 1:16750429-16750451 AGGGAAAGAGCAGGAATGGGTGG - Intronic
902736347 1:18403834-18403856 AGGCAGAAGGCAGGGGAGGAGGG - Intergenic
903078965 1:20793905-20793927 AGCCACAAAGCAGGAGTGAAAGG - Intergenic
903437221 1:23359641-23359663 ATGCAAAAAGCATTAGTGAAGGG + Exonic
905287194 1:36889260-36889282 AGGCAAAGGGCAGGAGAGGGTGG + Intronic
906683982 1:47750976-47750998 AGGCAAATGGCAGGAGGGAATGG - Intergenic
906713266 1:47948473-47948495 AGACAAAAGACAGGAGTTGAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907880127 1:58541446-58541468 AGGAAAAAAGCAGCAGGGGAAGG + Intronic
907892728 1:58650938-58650960 AAGCAAAAAGAAAGAATGGAAGG - Intergenic
908232721 1:62121832-62121854 AAGCAGAAAGCTGGAGTGCATGG + Intronic
908536855 1:65086254-65086276 AACCAAAAAGCAGGTATGGAAGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
909841951 1:80338388-80338410 AAGGAAAAAGCAGGAGCTGATGG - Intergenic
909856700 1:80542780-80542802 AGGCAAAAAGAACAAGGGGATGG - Intergenic
910345315 1:86229758-86229780 AGAAAAAAAGCAGGAGATGAAGG + Intergenic
911050903 1:93670374-93670396 AGGCAGAAGGCAGGCCTGGAAGG - Intronic
914044052 1:144077037-144077059 AGGCAAAAAGCTGCGGTGGCGGG - Intergenic
915476546 1:156155962-156155984 AGGAAGAAAGCAGGGGTGGTTGG + Intronic
915587708 1:156853075-156853097 AGGAAAAAAGCAGTAGAGAAAGG - Intronic
916616469 1:166446337-166446359 AGGCAGAAGGGAGGAGTGGTGGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918533883 1:185552862-185552884 AAGCAAAAAGAAGGGGTGGTAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919605612 1:199679338-199679360 AGGCAAAAAGTATGAGTTGTGGG - Intergenic
919669372 1:200324952-200324974 AGGCAAACAACAGGATTGAATGG - Intergenic
920601874 1:207333929-207333951 AGACAAAAAGGAAGAGGGGAAGG + Intronic
920618003 1:207513470-207513492 AGGCACAGTGCAGGAGTAGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920683992 1:208095294-208095316 AGGGAAAAAGCAGAAATGGAGGG - Intronic
921837719 1:219795129-219795151 AGGTGAAAAGCAGGGGTGGGGGG - Intronic
921965073 1:221079551-221079573 AGACAAAAAGCAGGAGAGTGGGG - Intergenic
922011257 1:221590566-221590588 AGGCAAGAATCATCAGTGGATGG + Intergenic
922324417 1:224514895-224514917 AGGCAAAATAAAGGAGTGTAAGG - Intronic
922345346 1:224691705-224691727 ATGTAAAAAGCTGTAGTGGATGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923873209 1:238018930-238018952 GGGAAAAGAGCAGGAGTGCAGGG + Intergenic
924002970 1:239574323-239574345 AGACAGAAAGAAGGAGAGGAGGG - Intronic
924227204 1:241932034-241932056 GGACAGAAGGCAGGAGTGGATGG + Intergenic
924691324 1:246354123-246354145 AAACAAAAAGGATGAGTGGAGGG + Intronic
1063200745 10:3783916-3783938 AGGAAAAAAACAGGAGGGGGAGG + Intronic
1063250163 10:4264978-4265000 ATGCAGAAAGCAGAAGTGAATGG + Intergenic
1063966767 10:11352127-11352149 TGGCAAGAAGCAGGAGTTGGTGG - Intergenic
1064974668 10:21101065-21101087 AGGCCTGAAGCAGAAGTGGATGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065482985 10:26213359-26213381 AGGGAAAAAGAAGGCCTGGAGGG - Intergenic
1065502031 10:26392059-26392081 AGGCAAAAAGCCGGAGCTGCGGG - Intergenic
1066244767 10:33571710-33571732 AGGCAAAGAGCAGGGGTGAGGGG - Intergenic
1066780724 10:38942588-38942610 AGGCAAAAAGACGCAGTGGCGGG - Intergenic
1066950621 10:42112637-42112659 GGGCAAAAAGCCGCAGTGGCAGG + Intergenic
1066950669 10:42112851-42112873 TGGCAAAAAGCCGTAGTGGTGGG + Intergenic
1066992021 10:42524651-42524673 ATGCAAATAGCAGAAGTTGATGG + Intergenic
1067182443 10:43998874-43998896 AGGCAAAATGCATCAGTGGAAGG - Intergenic
1067656163 10:48193237-48193259 AAGCAGAAAGCAGAAGGGGATGG - Intronic
1067935997 10:50612470-50612492 TGGCGAAAAGGAGGAGTGGAGGG + Intronic
1068070709 10:52191291-52191313 AGGAACACAGCAGGAGTGGCAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070486470 10:76936745-76936767 GGGAAAAAGGCAGGTGTGGAAGG + Intronic
1070956195 10:80465108-80465130 GGGCAAGGAGCAGGAGTGGCCGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073983453 10:109181203-109181225 AGGCAGAAGACAAGAGTGGAAGG + Intergenic
1074119055 10:110479759-110479781 AGGCAAAAACCAGGGGTGGCTGG - Intergenic
1074447251 10:113530616-113530638 AGGGAAAGAGCAGTAGGGGAGGG + Intergenic
1074947203 10:118292164-118292186 AGACAAAAAGTAGGAGTTGGGGG - Intergenic
1075311928 10:121421678-121421700 GGGCAGAAAGCGGGAGAGGAGGG - Intergenic
1075420730 10:122298546-122298568 ACCCAAAAAGCAGGAATTGAAGG - Intronic
1076215092 10:128686994-128687016 AGGGAGAAGGCAGGACTGGATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076507804 10:130989463-130989485 AGGCAAAAACCAGGCTCGGATGG - Intergenic
1077180302 11:1209270-1209292 AGGGAAAAGGGAGAAGTGGAGGG - Intergenic
1077749461 11:4948893-4948915 AGAGAAAAAGCAACAGTGGAAGG - Intronic
1077917394 11:6620315-6620337 AGGACAACAGCAGGAGTAGAGGG - Intergenic
1078211196 11:9270866-9270888 AGGCAAGAAGCAAGACTGGAGGG - Intergenic
1078610332 11:12814076-12814098 AGGCAGCAAGCAGGAGGTGAAGG - Intronic
1079456874 11:20643911-20643933 AAGCAAATGTCAGGAGTGGAGGG + Intronic
1079597640 11:22270558-22270580 TGGCAAAAAAGATGAGTGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080505652 11:32910574-32910596 ATGCAAAAGGTAGGAGTGAAAGG - Intronic
1081787500 11:45757618-45757640 ACGGAAATATCAGGAGTGGATGG + Intergenic
1081943571 11:46966960-46966982 AGGCAAAAATCTGGAAGGGAAGG - Intronic
1083069549 11:59962538-59962560 TGGGAGAAAGGAGGAGTGGAGGG + Intergenic
1083609830 11:63999492-63999514 AGGCAAGGACCAGGAGTGGGCGG - Intronic
1084545121 11:69811513-69811535 ACACAAAAAGCAGGAAGGGAAGG + Intronic
1084595139 11:70112376-70112398 AGCCAAGAAGCAGGAGAGAAGGG + Intronic
1084766397 11:71311787-71311809 AAGCACAGAGCAGGTGTGGAGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085695005 11:78696778-78696800 AGGCTAAAAGCATCAGTGAAGGG - Intronic
1085873168 11:80374241-80374263 AGAAAAAAAGCAAGACTGGAAGG - Intergenic
1087305480 11:96484646-96484668 AGTCAAAAAGCAGAGGAGGAGGG - Intronic
1087766960 11:102165502-102165524 TGGCAAAAAGCGTGACTGGAGGG + Intronic
1088121877 11:106379525-106379547 AGGCAGAAAGTGGGAGTGGGGGG - Intergenic
1088166680 11:106946548-106946570 AGAAAAAAAGCAGCAATGGAGGG + Intronic
1088206977 11:107403725-107403747 CGGCAAAAAGCAGGAGGAAAGGG - Intronic
1088462879 11:110101260-110101282 AGGAAAAAAGCAAGAGTGTTAGG + Intronic
1088757293 11:112896318-112896340 AGGCCAGGAGCAGGAGTGGGAGG - Intergenic
1089357448 11:117863191-117863213 AGGCAGCAAGAAAGAGTGGAAGG - Intronic
1089579514 11:119472751-119472773 AGGCCAAGAGCAGGAGTGCAGGG + Intergenic
1090115053 11:123961463-123961485 AAGCAAAGAGGAGGAGTGTAAGG + Intergenic
1090841226 11:130488884-130488906 AGGCAAAAAGCAAAACTCGATGG - Intergenic
1090855372 11:130605994-130606016 AGGCATAAAGCTGGCTTGGATGG + Intergenic
1091120988 11:133057423-133057445 AGGCACAGAGCAGGACAGGAAGG - Intronic
1091640956 12:2236911-2236933 AGGCTAACTGCAGGACTGGAGGG - Intronic
1091645676 12:2270649-2270671 ATGGAGGAAGCAGGAGTGGAAGG + Intronic
1091703570 12:2679417-2679439 AGGCAAGAAGGAGGGGTGGGTGG - Intronic
1092092328 12:5813079-5813101 AGGAAAAAAGGAAGAGAGGAAGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093691396 12:22113671-22113693 AGGCAAAGATTAGGAGTGGTTGG - Intronic
1094203578 12:27817381-27817403 AGGGAAGAAGAAGGAGGGGAGGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095375641 12:41525079-41525101 AGGCAAAAATCAGGAGTTTTAGG + Intronic
1095849990 12:46791952-46791974 GGGCAAAAAACAGGACAGGAGGG + Intronic
1095970808 12:47901020-47901042 TGGTGAATAGCAGGAGTGGAAGG - Intronic
1096022914 12:48337126-48337148 GAGCAAAGAGCAGGAATGGAGGG + Intergenic
1096086003 12:48865497-48865519 AGCCAAAAAGCAGCTGAGGATGG + Intronic
1096135421 12:49196112-49196134 AGGGAAAAGTCAGGACTGGAGGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096801797 12:54115347-54115369 AGGCAAAAAGGGGGAGTGACAGG + Intergenic
1097403633 12:59161057-59161079 TGGCAAAAAGGTGAAGTGGAAGG + Intergenic
1097967334 12:65595313-65595335 AGGTAAGAAGCGGGAGTGGGCGG - Intergenic
1099013046 12:77314266-77314288 AGGCAGAAGGCAGAAGTGCAAGG + Intergenic
1099187806 12:79534875-79534897 AGGGAAAAACCAGGATGGGACGG + Intergenic
1099817646 12:87669241-87669263 AGGGAAGTAGCAGGAGTAGAAGG - Intergenic
1100162051 12:91871918-91871940 AGAGAAAAAACAGAAGTGGATGG + Intergenic
1101751079 12:107582824-107582846 GGGCAATGAGCAGGAGTGGTGGG - Intronic
1101806715 12:108070275-108070297 AGGAGAAAAGCAGCAGTGTAGGG + Intergenic
1101854675 12:108432388-108432410 AGCCTAAAATGAGGAGTGGAGGG - Intergenic
1101918278 12:108912655-108912677 GGGCAAAAAGCAGGAGGCCAGGG + Exonic
1102055812 12:109895637-109895659 AAGCAAGAAGCTGGAGTGGTTGG + Intergenic
1102194897 12:111018156-111018178 AGGCAAAGAGAAAGAGAGGAAGG + Intergenic
1102397802 12:112602256-112602278 AGGCACCATGAAGGAGTGGAAGG - Intronic
1102764743 12:115422999-115423021 AGGAAAGAAGGAGGAATGGAAGG + Intergenic
1102809294 12:115810161-115810183 ACGCAAAACGCAGGGATGGAAGG - Intergenic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103690240 12:122766750-122766772 AGGCCACAGGCAGGAGAGGAGGG - Intronic
1104114111 12:125732589-125732611 AGGCAGAAGACAGGAGTGGGGGG + Intergenic
1104287892 12:127441931-127441953 AGGCAGAAAGCTGGAGTCGGTGG - Intergenic
1104727247 12:131085579-131085601 AGGTGGAAACCAGGAGTGGAAGG + Intronic
1105214059 13:18274130-18274152 AGGGAAAGAGCAGGAGCGGCCGG + Intergenic
1106339357 13:28814363-28814385 AGGCAAACACAAGGAGTAGACGG - Intergenic
1106616381 13:31333186-31333208 AAAAAAAAAGCAGGAATGGATGG + Intergenic
1106909487 13:34448190-34448212 AGCCACAGAGCAGGAGTTGATGG - Intergenic
1106931211 13:34667809-34667831 GTGAAAAAAGCAGGAGTGGGAGG + Intergenic
1107386101 13:39911180-39911202 AGGAGAAAAGCAGGGCTGGAGGG + Intergenic
1107436551 13:40385485-40385507 AGGAAAAAAACAGAAGGGGAAGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110236367 13:73221684-73221706 AGGCACTTAGCAGGTGTGGAGGG - Intergenic
1110733982 13:78912933-78912955 AGGCAATTAGCAGGAGGTGATGG + Intergenic
1110951528 13:81498729-81498751 AGGCAAAAAGGAGAAATGGTTGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111980962 13:95014557-95014579 AGGGAAGAAGCAGGATTGGGTGG - Intergenic
1113534720 13:111056598-111056620 TGGCAAATAGCAGCAGTGGATGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114453898 14:22843445-22843467 AGGGAACAAGCAGCAGAGGAGGG - Intronic
1114559346 14:23579070-23579092 AGGAGAAAAGCAGGGGAGGAGGG + Intergenic
1114885441 14:26843917-26843939 AAGAAAAAAGCAGGAGGAGAGGG - Intergenic
1115100750 14:29695425-29695447 AGGGTAAAAGCAGTAGAGGATGG + Intronic
1115899028 14:38124640-38124662 AGGCAATAAGGAGGAGGAGAAGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117472360 14:56058923-56058945 AGGAAATGAGCAGGAGTGAAGGG + Intergenic
1117502561 14:56367955-56367977 AGGGATACAGCAGGAGTGGTGGG - Intergenic
1117847788 14:59931380-59931402 AGGAAAAAAGGAGGAGTAGGAGG - Intronic
1118346740 14:64946581-64946603 AGGAAAACAGCAGGAGAGGGTGG - Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119640616 14:76311648-76311670 AGGCCAAAGCCAGGTGTGGAGGG + Intronic
1119644182 14:76336647-76336669 AGGGCAAAAGCAGGAGTGAGAGG + Intronic
1121289213 14:92760760-92760782 GGGGAAAAAGAAGGAATGGAGGG - Intergenic
1121813336 14:96910761-96910783 AGGCACAGAGCAGGTATGGAGGG + Intronic
1122126448 14:99581115-99581137 AAGCAAAGAGGAGGAGTGGGAGG + Intronic
1122171160 14:99876763-99876785 AGCAAAAAAGGAGGAGGGGAGGG - Intronic
1122599912 14:102916044-102916066 AGGCAAGAGGCAGGAGAGGAGGG - Intergenic
1122703424 14:103605485-103605507 ATGAAAAAAGCTGGAGTGGTAGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123179085 14:106451058-106451080 ATGGAAGAAGCAGGAGTAGAGGG - Intergenic
1123213224 14:106781659-106781681 AGGGAAGAAGCAGGGGTAGAGGG - Intergenic
1123396806 15:19944560-19944582 GGGCAAAAAGCCGCAGTGGCAGG - Intergenic
1123813691 15:23955118-23955140 AGGCAGACAGCAGGAGTGAGTGG + Intergenic
1123871464 15:24578936-24578958 GGGCAGAAAGCAGGATTGTAAGG + Intergenic
1123987945 15:25661545-25661567 AGGCAAGAAGCAGGTGTGGGGGG - Intergenic
1124018454 15:25898387-25898409 AGGCAAAGAGCAGGAGTGGTGGG + Intergenic
1124251564 15:28109531-28109553 GGGAAAAAGGCAGGAGGGGAAGG + Intergenic
1124572944 15:30882861-30882883 AGGCACAAAGAAGAACTGGACGG - Intergenic
1124949803 15:34306601-34306623 AGGCTGGAAGCAGGAATGGAGGG + Intronic
1125223659 15:37369333-37369355 GGGCAAAAAGATGGGGTGGAGGG + Intergenic
1126420087 15:48463250-48463272 AGGTAAAAAAAAGGATTGGAGGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127143932 15:56005739-56005761 TGACAAGAGGCAGGAGTGGAGGG + Intergenic
1127242305 15:57129919-57129941 AGGCAAAAAGGAGGGGTTGTTGG - Intronic
1127818798 15:62637361-62637383 AGGAAAATAGCAGGACTGAAAGG + Exonic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128493493 15:68174468-68174490 TGGCAAAAAGCAGGAGGAAAAGG - Intronic
1128940469 15:71784006-71784028 AGGCAAAAAGGTGGATGGGAAGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129785064 15:78304410-78304432 AGCCAAACTGCAGGAGAGGATGG + Intergenic
1130297452 15:82657131-82657153 AGGCAGGAAGCAGGAGAGCAAGG - Intergenic
1130813422 15:87405865-87405887 AGGCAGAAAGCAGAAGTGAGGGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132086614 15:98913485-98913507 AGGCACAAAGCAGGAGATGATGG - Intronic
1132171687 15:99664318-99664340 AGGCAAGAGGCAGGAGTAGCTGG + Intronic
1132293336 15:100718328-100718350 ATTAAAAAAGGAGGAGTGGACGG + Intergenic
1132606271 16:795027-795049 AGGCGGCAGGCAGGAGTGGAGGG + Intronic
1132878301 16:2149850-2149872 AGGTGAGGAGCAGGAGTGGAGGG - Intronic
1132918019 16:2364682-2364704 AGGAAGAAAGAAGGAGAGGAGGG + Intergenic
1133073426 16:3262041-3262063 AGGCACGGAGGAGGAGTGGATGG + Intergenic
1133200695 16:4202746-4202768 AGGGCAATAGCAGGAGGGGAAGG + Intronic
1133479852 16:6159597-6159619 GTGAAAAAAGCAGGAGGGGAAGG - Intronic
1133606357 16:7392001-7392023 TTGCAAAAGGCAGGAGGGGAAGG - Intronic
1133758654 16:8781055-8781077 AGGGAAAAAGGAAGTGTGGAGGG + Intronic
1134488674 16:14679113-14679135 TAACAAAAAGCAGGAGTGCATGG - Intronic
1135151206 16:20007745-20007767 AGGAAAAAAGCATGAGTAGATGG - Intergenic
1135265814 16:21024553-21024575 AGGGAGACAGCAGGAGGGGAAGG + Intronic
1135305038 16:21360455-21360477 ATGCAAAAGGCAGAAGTGAAAGG - Intergenic
1135406120 16:22199260-22199282 AGGCAAAAAGCAGGCCTTGCGGG + Intergenic
1136072596 16:27796983-27797005 TGGCACACAGCAGGAGTGGGAGG - Intronic
1136301783 16:29339648-29339670 ACGCAAAAGGCAGAAGTGAAAGG - Intergenic
1136696494 16:32085390-32085412 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1136796992 16:33028664-33028686 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1138203055 16:55104422-55104444 AGCCAGAAAGCAGGTGTAGAGGG - Intergenic
1140134952 16:72197680-72197702 AGCCACAAAGAAGGGGTGGAGGG - Intergenic
1140945897 16:79768200-79768222 GGGCAAACAGAGGGAGTGGAGGG + Intergenic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1141985977 16:87580306-87580328 AGTCAAAAAGCAGGGGTGTTGGG + Intergenic
1142063477 16:88046201-88046223 ATGCAAAAGGCAGAAGTGAAAGG - Intronic
1142553516 17:755968-755990 AGGGAAAGAGCAGGAAGGGAGGG - Intergenic
1143097633 17:4486862-4486884 AGGTATAAAGCAGGAAAGGAAGG + Intronic
1143272227 17:5684214-5684236 AGGCAAAACTAAGGAGTGCATGG - Intergenic
1143736866 17:8917006-8917028 AGGTAAGAAGCAGGAGAGGGAGG - Intronic
1146644218 17:34566172-34566194 AAGCATCAAGCAGGAATGGAAGG + Intergenic
1147515879 17:41117292-41117314 AGGGAGAAAGCAGGAGAGCATGG + Exonic
1148074209 17:44926343-44926365 AGACAAGAAGGAGGAGGGGACGG - Intronic
1148091253 17:45023736-45023758 AGGCGAGAAGCAGGGGTGGCAGG + Exonic
1148792985 17:50183992-50184014 AGGGAAAGGGCAGGAATGGAAGG + Exonic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149106864 17:52979348-52979370 AGGCAAAAACCTGGATTTGAAGG - Intergenic
1149181527 17:53943541-53943563 AGGCAAGAAGAAGGAAAGGAGGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149795458 17:59515012-59515034 AGACAAAAATCAGCAGAGGAAGG - Intergenic
1150506645 17:65705521-65705543 GGACAAAAAGCAGGAGAGCATGG + Intronic
1151149561 17:72072666-72072688 AGGAAGAAAGCTGGAGAGGAAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151406381 17:73889755-73889777 ATGCCAAAAGCAGGGGTGGTCGG - Intergenic
1151632310 17:75319181-75319203 GGAGACAAAGCAGGAGTGGAAGG - Exonic
1151643913 17:75416522-75416544 AGGAAGAAAGCAGGAAGGGAAGG + Intergenic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1152911113 17:83005347-83005369 AGGCAAACACCGGGAGTCGAGGG + Intronic
1153036735 18:770652-770674 AGGCAAAAAGCCAGGGTGGGTGG + Intronic
1153212066 18:2778376-2778398 AGGCAAAACGTAGGAATGAATGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153548141 18:6231341-6231363 AGGCAAAAACAAGCAATGGATGG - Intronic
1154086514 18:11310630-11310652 AGGCAGAGGGCAGGGGTGGATGG + Intergenic
1154105319 18:11517886-11517908 AGGCTAAGAGCAGGACTGGTAGG + Intergenic
1155431757 18:25766600-25766622 AGGCATGAAGCAGGAATTGATGG - Intergenic
1156167860 18:34444682-34444704 GGGAAAAAAGAAGGATTGGATGG + Intergenic
1156441310 18:37191040-37191062 ATGAATAAAGCAGGAATGGATGG - Intronic
1157051951 18:44176507-44176529 AGCCAGAGAGCAGGAATGGAAGG + Intergenic
1157090152 18:44627378-44627400 CGTCAAAAAGGGGGAGTGGATGG + Intergenic
1157112544 18:44834560-44834582 AGGCACAGAGCAGGAGAAGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157332916 18:46716525-46716547 TGGCAAAGAGGAGGTGTGGAAGG - Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158185165 18:54763162-54763184 AGACAAAAAGCAGTAAGGGAGGG + Intronic
1158290120 18:55931519-55931541 AGGAAAGAATGAGGAGTGGAAGG - Intergenic
1160106845 18:75986505-75986527 AGGGAAAAAGAGGGACTGGAGGG + Intergenic
1160227586 18:77023389-77023411 AGTCCAAAAGAAGGAGTGGCAGG - Intronic
1160356197 18:78229857-78229879 AGGAAGAAAGCAGGAAGGGAAGG - Intergenic
1160490635 18:79334641-79334663 AGACAAGAGGCAGGGGTGGAGGG - Intronic
1161494584 19:4580472-4580494 AGGCGGAGAGCAGGAGAGGAGGG + Intergenic
1161777802 19:6273252-6273274 AGGCAACCAGAAGGAGTGGCTGG + Intronic
1161783240 19:6307396-6307418 AGGGAAAGAGCAGGAATTGAGGG + Intronic
1164004229 19:21134236-21134258 AGGGAAGAAGGAGGAATGGAGGG + Intergenic
1164292301 19:23879531-23879553 AGAGAAAAAGGAGGAGAGGAAGG + Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1165380010 19:35472568-35472590 GGGCAAGAGGCAGGAATGGAGGG - Intergenic
1165700906 19:37936875-37936897 AGGCAGGAAGCAGGAGTGGAGGG - Intronic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1167198561 19:48047989-48048011 AGTCATAAAGGAGCAGTGGAAGG + Exonic
1167417147 19:49380775-49380797 AGGAAGAAAGCAGTAGAGGATGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168487752 19:56779127-56779149 AGGAGAAAGGCATGAGTGGACGG + Intronic
1202704630 1_KI270713v1_random:13811-13833 AGGGAAAGAGCAGGAATGGGTGG + Intergenic
926139694 2:10360873-10360895 AGACAGAAAGCAGGGGAGGATGG - Intronic
926263474 2:11291012-11291034 ATGCAAAAAGCATGAGAGAAAGG + Intronic
926311352 2:11678307-11678329 AAGCCCAAAGCAGGAGTGGAGGG + Intronic
926893766 2:17661656-17661678 AGGAACAATGCAGAAGTGGAGGG - Intergenic
927731707 2:25479011-25479033 AGGCAAAAAGCAGAAAGGGAAGG - Intronic
928224824 2:29439739-29439761 AGGCCAGAAGCAGAAGTGGGAGG + Intronic
928910728 2:36418219-36418241 AGGCACAGTGCAGGAGTGCAAGG + Intronic
929119550 2:38473138-38473160 AAGCAAAAAGTAGAAGTAGAAGG + Intergenic
929438591 2:41948059-41948081 AGGACAAAAGGAGGAGTAGATGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930373877 2:50539855-50539877 GGACAAAAAGAAGAAGTGGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932397168 2:71456115-71456137 AGGCAAAAAGCAGATGGGGGTGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932922040 2:75927373-75927395 AGTGAAAAAGCTGGACTGGAAGG + Intergenic
933038770 2:77433745-77433767 ACACAAACAACAGGAGTGGAAGG + Intronic
934039832 2:88118573-88118595 AGGCAGAGAGGAGGCGTGGAGGG + Intergenic
934300260 2:91772620-91772642 AGGGAAAGAGCAGGAGCGGCCGG - Intergenic
934307589 2:91840063-91840085 GGGCAAAAAGCCGCAGTGGCGGG - Intergenic
934887480 2:98037728-98037750 AGGCCCCCAGCAGGAGTGGAGGG + Intergenic
935538774 2:104325582-104325604 AGGAAAAAAGAGGGAGAGGAGGG - Intergenic
935686900 2:105691860-105691882 AGGGAAAAAGCAGGAGAGACAGG + Intergenic
936048367 2:109203778-109203800 AGACAAAGGGCAGGAATGGATGG - Intronic
936339742 2:111620707-111620729 AGGATGAAAGGAGGAGTGGAAGG - Intergenic
936732654 2:115402667-115402689 AGGAAAAGCGCAGGACTGGACGG + Intronic
938051620 2:128177974-128177996 ATGCAAAAAGGAGGGATGGATGG - Intronic
938754664 2:134368771-134368793 AGGTACAGAGCAGGAGTGGCTGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940010007 2:149042458-149042480 TGGAAGAAAGCAGAAGTGGAGGG + Intronic
940185118 2:150975837-150975859 ATGGAAAAAGTAGGAGTGTAGGG - Intergenic
940316302 2:152330965-152330987 AGGCAGAAAGCAGGGGGGAAGGG - Intergenic
940378134 2:152980919-152980941 AGGGACAAATCAGGAGAGGAGGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941352436 2:164453309-164453331 AGAGAAAAAGTAGGAGAGGATGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943177573 2:184496694-184496716 AGGAAAATTGCAGGACTGGATGG + Intergenic
943411106 2:187549326-187549348 AGCCAAGAAGCAGGGGAGGAAGG + Intronic
943566001 2:189517566-189517588 AGGCCTAAAGCGGGAGGGGAAGG + Intergenic
943877218 2:193084581-193084603 TGGCAAAAAGAAAGAGTCGAAGG + Intergenic
944537645 2:200726696-200726718 AGTTAAGAATCAGGAGTGGATGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945818961 2:214639356-214639378 AGGCAAAGAGCAGTAAAGGAAGG + Intergenic
947450971 2:230208603-230208625 GAGCAAAAAGCAGGAGGTGAGGG + Intronic
947817988 2:233050863-233050885 AGAAAAAAAGGAGGAGAGGAGGG + Intergenic
947845751 2:233242354-233242376 AGACAAAAAGCCGGAGTGCGTGG + Intronic
948144620 2:235699163-235699185 AGGAGAAAAGCTGGAGGGGAAGG - Intronic
948234976 2:236380600-236380622 AGGCAAAAAGAAAGAGAAGAAGG - Exonic
948321658 2:237074511-237074533 AGGAAAAGAGCAAGAGTGGATGG + Intergenic
948387087 2:237587438-237587460 AGAAGAAAAGCAGGAGTGGTTGG + Intronic
948389556 2:237602127-237602149 AGGCGACCAGCAGGATTGGAAGG - Intergenic
948588741 2:239036569-239036591 AGGCAGGAAGCAGGAGGGGGCGG - Intergenic
1169748432 20:8966439-8966461 AGGCAGAAAGCAGAAGTTGGGGG + Intronic
1169849486 20:10034411-10034433 CGCCAAAAAGCATGTGTGGAGGG + Intronic
1169853149 20:10075307-10075329 AGGCAAAATGCAGGAGTTCGAGG + Intergenic
1170456405 20:16537616-16537638 AGGCAAGAACCAGGAATGTAGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172479595 20:35263303-35263325 TGGAACAAAGCAGGAGGGGAGGG - Intronic
1172508753 20:35484550-35484572 AGGCAAAAAGAAGGAGGACATGG - Intronic
1172617558 20:36299180-36299202 AGGCGAAAAGGAGGAAGGGAAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173074991 20:39809692-39809714 AGGCAAACAGCGTGAGGGGATGG + Intergenic
1173790774 20:45826569-45826591 AGGGAAAGAGGAGGAGAGGAAGG - Intronic
1174151878 20:48491772-48491794 AGGCAAACAGAGGGAGAGGAAGG - Intergenic
1174289836 20:49500242-49500264 AAGCAAACAGCAGGAGGTGATGG - Intergenic
1175593454 20:60212172-60212194 AGGCCAGAAGCAGGTGCGGAGGG + Intergenic
1175874872 20:62224575-62224597 AGGAGAACAGCAGGAGTGAAGGG + Intergenic
1177100483 21:16893439-16893461 AGAGAAGAAGCAGGAATGGAGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178163772 21:29948549-29948571 AGGCAAAAAGAAGGAGGAGAAGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179280777 21:39932059-39932081 AGGCAAAATGCATGAGTGTCTGG + Intergenic
1180139085 21:45880426-45880448 ATGAAAAACGCAGGAGTGGGTGG + Intronic
1180281258 22:10698902-10698924 AGGCAAAAAGCTGCAGCGGCGGG - Intergenic
1180579920 22:16824474-16824496 AGGGAAAAAGAAGGAATGGAGGG + Intergenic
1181898888 22:26136170-26136192 AGGCAAAAAGAGGGAGTACAAGG - Intergenic
1182050678 22:27310546-27310568 AGGAAAAAAGGAAGAGAGGAAGG + Intergenic
1183279768 22:36925740-36925762 AAGCAAGAAGCAGGTGAGGAGGG - Intronic
1183413734 22:37671090-37671112 AGGCCAATGGCAGGTGTGGAGGG + Intergenic
1184294624 22:43515670-43515692 GGGCAGAAAGCAACAGTGGAAGG + Intergenic
1184325064 22:43776685-43776707 AAGAAAAAGGCTGGAGTGGACGG + Intronic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
1185159402 22:49213929-49213951 GGGCAAGAAGCAGCAGTGGAAGG - Intergenic
1185343898 22:50303126-50303148 AGGCCAGAAGCAGGAGTGTGGGG - Intronic
949510218 3:4760793-4760815 AGGCAGGAGGCAGGAGAGGAGGG - Intronic
949670700 3:6396700-6396722 AGTCCAAATGCAGGAGTTGAAGG + Intergenic
950156246 3:10723650-10723672 AGGCCAAACGCAGGAGTGCGGGG + Intergenic
950172952 3:10852023-10852045 AGGCATAAAGCAGGAGTAGAGGG + Intronic
950462873 3:13135636-13135658 AGGCAAGGAGCCGGAGTGGGTGG + Intergenic
950841988 3:15976627-15976649 AGGCAGAGAGCAGCAGGGGAGGG - Intergenic
951546367 3:23829981-23830003 AGGTAATAAGAAGGAGTGGAGGG - Intronic
953543393 3:43842237-43842259 TGACAAAAAGCTGGAATGGAAGG - Intergenic
953573505 3:44093202-44093224 AGGCAGAAAGCAGGTGGGGCAGG - Intergenic
954100125 3:48365737-48365759 AAGCAAAAAGAAGAAGAGGAGGG + Intergenic
954682943 3:52355656-52355678 AGGCCAGAAGCAGGTGGGGAGGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955977048 3:64489529-64489551 CGGCAAGGAGCAGGAGTGCAGGG + Intergenic
957024603 3:75167188-75167210 AGGCAAAAAGCGTGTGGGGAGGG + Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958927142 3:100171230-100171252 AGCCAAAAAGCAGGAAAAGAAGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960574623 3:119217882-119217904 AGGCAACAAGCAGGAGGGAAGGG + Intronic
961199215 3:125030798-125030820 AGTCAAAAAGCAGGAGGGCCAGG + Intronic
961714165 3:128847428-128847450 AAACAAAAAGGAGGTGTGGAGGG + Intergenic
962085773 3:132189898-132189920 AGGCTAAAAGCAGGTTTGGCAGG + Intronic
962795358 3:138845196-138845218 AGGCAAAGAGCAGGAGAGGAAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963475424 3:145798075-145798097 AGGCAGAAAGCAGAATTAGATGG + Intergenic
963631477 3:147736356-147736378 TGGCAAAAAGAAGAAATGGATGG + Intergenic
964175426 3:153821941-153821963 AGGAAAGAATCAGGAGTGAAGGG + Intergenic
964661409 3:159124176-159124198 AGGAAGAAAGAAGAAGTGGAAGG - Intronic
965153107 3:165008309-165008331 AGGCTCAGGGCAGGAGTGGAGGG - Intronic
966218605 3:177528173-177528195 AGGCAAAAAGTTGGAATTGATGG + Intergenic
967409569 3:189153770-189153792 AGGCAAAAAGCAGAACTGATTGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969557481 4:7922565-7922587 AGGCAACAAGCTGGAGTGCAAGG + Intronic
969854896 4:9991180-9991202 AAGCAGAAAGCAGCAGGGGAAGG - Intronic
970232686 4:13927201-13927223 GGGCACGAAGCAGGAGTGGGTGG + Intergenic
970284588 4:14495905-14495927 GGGCATAATGCAGGAGTGAATGG + Intergenic
970383721 4:15535353-15535375 ACTCAAAAAGAAGGAGGGGAGGG - Intronic
970530194 4:16974022-16974044 ATGCACAGAGCTGGAGTGGAAGG + Intergenic
971149798 4:24020102-24020124 AGCCAAGATGAAGGAGTGGATGG - Intergenic
972431067 4:38982830-38982852 ACCCACACAGCAGGAGTGGATGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973304869 4:48635093-48635115 AGGGAAGAAGCAGAGGTGGAAGG + Intronic
975293888 4:72709623-72709645 AGGCAAAAAGGAGTTCTGGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975381846 4:73709812-73709834 AGGAAAAAAGCAAGAAAGGAAGG - Intergenic
975770812 4:77720460-77720482 TGACAAGAGGCAGGAGTGGAGGG + Exonic
975776833 4:77796547-77796569 AGGCAAGAAGCATGACTGGGAGG - Intronic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976750148 4:88445068-88445090 AGGGAAGTAGCAGGAGTTGAGGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977568578 4:98607632-98607654 AGGCAAAAAGCATGTAAGGAAGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978736820 4:112093149-112093171 AGAGAGAAAGCAAGAGTGGAGGG + Intergenic
978777558 4:112517810-112517832 AGGTAACAAGGAGGATTGGAAGG + Intergenic
978850711 4:113332570-113332592 AAGCAAAAACCACGAGTGCATGG + Intronic
978908326 4:114036271-114036293 GGGCAAAAAAGTGGAGTGGAGGG + Intergenic
979522362 4:121683204-121683226 AGGCAATAAGCAGTAAAGGAGGG - Intronic
979522371 4:121683343-121683365 AGGTAAAAAGGATGAGTGAAAGG - Exonic
979736216 4:124088614-124088636 AGACAGAAAGTAGGAGCGGAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980603886 4:135064178-135064200 ATGCAATAAACAGGAATGGAAGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980807550 4:137833214-137833236 AGTCCAAAAGCAGGAGAAGATGG + Intergenic
981678420 4:147366006-147366028 AGTCACAAAGCTGGTGTGGATGG + Intergenic
982017958 4:151174644-151174666 AGTGAAAAATCAGCAGTGGAGGG - Intronic
982610639 4:157569853-157569875 AGGCAAAAAGCAAAAGAGCAAGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983543160 4:168934699-168934721 AGGAAAAAACCAGGACTGGATGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984490158 4:180424211-180424233 AGGGAAGAAGTAGGAGAGGAGGG - Intergenic
984656543 4:182324714-182324736 AGGCAAACAGCAGGACTGCTTGG - Intronic
984855347 4:184190332-184190354 AAGCACAAAGCAGAAATGGAAGG - Intronic
985273241 4:188214393-188214415 AGGAAAAAAACCAGAGTGGATGG - Intergenic
985445775 4:190020731-190020753 AGGAAAAAACCAGGGGAGGAAGG - Intergenic
985767584 5:1787929-1787951 AGAAAAAGAGCAGGAGGGGAGGG - Intergenic
986057486 5:4153128-4153150 AGGCAAGAAGGATGAGCGGACGG + Intergenic
986555866 5:9009201-9009223 GAGCAAAAAGCAGGAGTACAGGG + Intergenic
987205864 5:15624976-15624998 TGGGAAAAAGCAGGAGGGGAGGG - Intronic
987723843 5:21671760-21671782 AGGGAAGAAGGAGGAATGGAGGG - Intergenic
987869954 5:23603256-23603278 AGGCAGAAGGCAGGACAGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988246669 5:28692610-28692632 AGGAAAAAAGTAGAGGTGGATGG + Intergenic
988587830 5:32523114-32523136 AGGCACAAAGAAGAACTGGACGG + Intergenic
988652459 5:33167286-33167308 GGGCAATATCCAGGAGTGGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990355193 5:54960101-54960123 AGGAAAGAAGCAGGATTGGGCGG + Intergenic
990508031 5:56464179-56464201 AGGCAGAAAGCAGGGGTACAGGG + Intronic
990986398 5:61644569-61644591 AGGCCAGAAGCTTGAGTGGAAGG + Intronic
991252390 5:64577994-64578016 AGACAAAAAGTAAGAGTGGATGG - Intronic
992163060 5:74021038-74021060 AAGCAAAAGCCAGGAGGGGAAGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992710297 5:79446358-79446380 AGACAGAAAGCAGGAGTGAGGGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993397969 5:87413898-87413920 AGGTAAAAAGAAGAAGTGGCAGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994537302 5:101048410-101048432 AGGGAAATAGCAGGAGTAGAAGG + Intergenic
995355977 5:111238181-111238203 AGGGAGAAATCAGGAGGGGACGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995658341 5:114452081-114452103 AGGGAAAAAATAGGAGTGCAAGG + Intronic
996145322 5:119967712-119967734 AGGGAAAAAGGAGGAGTGTAGGG + Intergenic
997068182 5:130588467-130588489 TGAAAAAAAGCAGGAGGGGAAGG + Intergenic
997585996 5:135043852-135043874 AGGCAAAAAGGAGCAGATGAAGG + Intronic
999098296 5:149001084-149001106 AGGGAATATGCAGGAATGGAGGG - Intronic
999232278 5:150068732-150068754 AGGGGAAATGCAGGAGAGGAAGG - Intronic
999264606 5:150258146-150258168 AGGCCAGAGGCAGGAGTGAAAGG + Intronic
999398849 5:151249126-151249148 AGGGAAGTAGCAGGAGTTGAGGG - Intronic
999419933 5:151431996-151432018 TGGCCAAAAGCATGAATGGATGG + Intergenic
999471420 5:151858260-151858282 AGGCAAAAGAAGGGAGTGGAAGG + Intronic
999505328 5:152188812-152188834 GAGCAAAAAACAGGAGAGGATGG - Intergenic
999512827 5:152270621-152270643 AGCCACACAGCAGGAGTGGTGGG + Intergenic
1000139220 5:158385217-158385239 AGGCCAAAAGCACCAGTGTATGG + Intergenic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1000890281 5:166793560-166793582 AGGAGAAAGGCAAGAGTGGACGG + Intergenic
1001679293 5:173544395-173544417 AGGGAAGAAGCAGGAGGGAAAGG - Intergenic
1004173584 6:13318869-13318891 AGGCAAGAATCATTAGTGGATGG + Intronic
1004818334 6:19336995-19337017 AGGCAGAAAGGAGGAAAGGAGGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005333589 6:24771974-24771996 CGGCAAAAGACAGGAATGGACGG - Intergenic
1005784464 6:29228911-29228933 AGGAAAAAAGCAAGAAAGGAAGG + Intergenic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1007175344 6:39892581-39892603 AGGCAATAAGCAGGAGAGGCTGG + Intronic
1008220363 6:48846509-48846531 ATGCAGAAAGCAGGGATGGAGGG + Intergenic
1008442632 6:51550226-51550248 AGGCAAAAAGAAGGAAAGGAAGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009295944 6:61947508-61947530 AGGAGAAAAACAGAAGTGGAAGG + Intronic
1009403644 6:63286769-63286791 AGGGCAAAGGCAGGATTGGAAGG - Intronic
1009504189 6:64454077-64454099 AGGCCAAAGGTAGGGGTGGAAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009964783 6:70566892-70566914 AGGCGCAAAGCAGTAGTGGGAGG - Intergenic
1010487404 6:76432084-76432106 AGGAAGAAAGCTGGAGTGGCTGG + Intergenic
1010639344 6:78304185-78304207 AGGATAAAAGCATGAGGGGATGG - Intergenic
1011097117 6:83678691-83678713 AGGGGAGGAGCAGGAGTGGAAGG - Intronic
1011549771 6:88520469-88520491 AGGGAAAAAGCAGGAAAGGAGGG + Intergenic
1011779843 6:90775622-90775644 AGGCAAAGAACTGGAGTTGAAGG - Intergenic
1012060716 6:94476451-94476473 AAGCAAACAGCTGGAGTGCATGG - Intergenic
1012439431 6:99249395-99249417 AGGCAAAAAGCAGTAGAAGAGGG - Intergenic
1012596004 6:101041054-101041076 GGGCAAAAAGAAGGAGAAGAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013199291 6:107877029-107877051 AGCCACAAAGTTGGAGTGGAAGG + Intronic
1013368415 6:109451484-109451506 AGGACAAAGGCAGGAGAGGACGG + Intronic
1013434685 6:110091298-110091320 AGGGAAAAAGGAGGATTGGTTGG - Intergenic
1013458846 6:110357109-110357131 AGGCTGGAAGCAGGAGTTGATGG + Intronic
1013502000 6:110761365-110761387 AGGCAATAAAAAGAAGTGGATGG + Intronic
1013502148 6:110763220-110763242 AGGCAAAGTGAAGGAATGGAGGG + Intronic
1013703923 6:112809926-112809948 AGACAAAAAGCAGGAGCCGTGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014374931 6:120660548-120660570 AGGCAAACTGCAAGAGTGGAGGG - Intergenic
1014588595 6:123232612-123232634 AGGGAGAAAGCAAGAGAGGATGG + Intronic
1014782339 6:125578736-125578758 AGGGAAAAAGTAGGAGTTCAAGG + Intergenic
1014817672 6:125953249-125953271 ATGCAACAAGAAGCAGTGGAGGG + Intergenic
1015309664 6:131752654-131752676 ATGGAAAAAGAAAGAGTGGAGGG - Intergenic
1015414318 6:132931666-132931688 AGGGAAAAAGCAAAAGAGGAAGG - Intergenic
1015598277 6:134887410-134887432 AGGCAAAGAGCACGTGTGCAGGG + Intergenic
1015844042 6:137499010-137499032 GGGAAAATAGCAGAAGTGGAAGG + Intergenic
1016027974 6:139308158-139308180 AGGCAAATAGGCAGAGTGGAAGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017287987 6:152700614-152700636 AAGCAAAAATAGGGAGTGGAAGG - Intronic
1017587079 6:155938262-155938284 AGGCACAAAGTGGGATTGGAGGG + Intergenic
1021449078 7:20764789-20764811 AGGAAAAGAGGAGAAGTGGAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022673253 7:32475677-32475699 AGGCAAAAAGCAGGTGTCCAGGG + Intergenic
1022837245 7:34130054-34130076 AGGAAGAAAACAGGAGAGGAGGG - Intronic
1023088476 7:36595971-36595993 AGGAAAAAAGCAGGAGGCCAGGG - Intronic
1023241415 7:38151536-38151558 TGGCAGTTAGCAGGAGTGGAGGG - Intergenic
1023473130 7:40546807-40546829 GAGCAAAAAGGATGAGTGGATGG - Intronic
1023784800 7:43695302-43695324 AGGTAAAAAGAAGGAGATGAGGG - Intronic
1023948639 7:44823588-44823610 AGGGAAGAAGAAGGAGGGGAGGG - Intronic
1023994136 7:45148543-45148565 AGACAAGGAGCAGTAGTGGAGGG - Intergenic
1024273603 7:47660074-47660096 AGGCAAAGGGCAGGAGATGAAGG - Exonic
1024709723 7:52002049-52002071 TGGGAAACAGCAGGAGAGGAAGG + Intergenic
1024813568 7:53241694-53241716 AGACAAAGAGTAGGAGGGGAAGG - Intergenic
1025487872 7:61074515-61074537 AGGAAAAAAGAAGGAGTTAAGGG - Intergenic
1025511974 7:61581398-61581420 AGGAAAAAAGAAGGAGTTAAGGG - Intergenic
1025561203 7:62376851-62376873 GGGCAAAAAGCTGCAGTGGCGGG - Intergenic
1025706008 7:63864764-63864786 AGGCTAAAGGCAGGAATGGGGGG + Intergenic
1026139146 7:67690164-67690186 AGGCAAAAACAAGAAGTGGAAGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028180793 7:87721289-87721311 AGCCAGAAAGCAGAGGTGGATGG + Intronic
1028241065 7:88421236-88421258 AGGCAAAAGGTATGAGTTGAAGG - Intergenic
1028285928 7:88998789-88998811 GGGCCAAAAGCAGGGGTGCAGGG + Intronic
1028357150 7:89924727-89924749 AGGCAAAAAGAAGGAAGGAAGGG + Intergenic
1028488293 7:91383893-91383915 AGGCAGCAAGGAGGAATGGAAGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030538449 7:110798645-110798667 AGGAAGAAAGCGGGGGTGGAGGG + Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034537604 7:151735580-151735602 AGGGGAAAAGTAAGAGTGGATGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035519124 8:262709-262731 AGGCAAGAAGTAGTAATGGATGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037900946 8:22689433-22689455 AGACACAAAGCTGGAGTGGCTGG + Exonic
1038701975 8:29857336-29857358 AGGCAACAGCCAGGAGTGGCAGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040291520 8:46127976-46127998 AGGCAGAAAGGAGAAGTGGCAGG - Intergenic
1041952275 8:63516948-63516970 AGACAAGAAACAGGAATGGAAGG + Intergenic
1041957757 8:63575148-63575170 AGAGTAAAAGAAGGAGTGGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044756046 8:95462037-95462059 AAGCAAAAAGGAAGAGAGGAAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045775513 8:105797804-105797826 AGGCTGATGGCAGGAGTGGAGGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046064821 8:109183660-109183682 TGGCACCAGGCAGGAGTGGATGG - Intergenic
1046099690 8:109600340-109600362 AGGCTGGAAGTAGGAGTGGAAGG - Intronic
1046299089 8:112262506-112262528 AGGAAAAAATCAGAAGTGAAAGG + Intronic
1046985210 8:120380504-120380526 AGTCCAAAAATAGGAGTGGATGG + Intergenic
1047075568 8:121398615-121398637 AGACAAAGAGCAGGAGAGGGAGG + Intergenic
1048359503 8:133685438-133685460 AGACAAAAACAAGCAGTGGAAGG - Intergenic
1048829166 8:138459342-138459364 AGGCACAAAGCAGCAGTGGCAGG + Intronic
1048918460 8:139206000-139206022 AGGCAAAGTGCAGAAGTTGAGGG - Intergenic
1049083190 8:140458104-140458126 AGGGAAAAAGGAGGGGTGAAAGG + Intronic
1050113755 9:2242276-2242298 ATGCAAAAAGAAAGGGTGGAAGG + Intergenic
1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG + Intergenic
1050395721 9:5193564-5193586 AGTCAAAAAGGAGGGGTGAAAGG + Intergenic
1050416430 9:5422170-5422192 AGGCAATGATCATGAGTGGATGG + Intronic
1050499087 9:6275988-6276010 AGGTAAAAAGCAGGGAGGGAGGG + Intergenic
1051599532 9:18858794-18858816 AACCAGAAAGCGGGAGTGGAAGG - Intronic
1052257683 9:26478065-26478087 AGACAGAAAGAAGGAGGGGAAGG - Intergenic
1052405076 9:28049449-28049471 AGGCAAAAAGGATAAGTGGCTGG + Intronic
1052993603 9:34537392-34537414 AGACAACAAGCTGGAGTTGAAGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053148433 9:35727712-35727734 AGCCAAGAAGCAGGACTGAAAGG + Intronic
1053229641 9:36396654-36396676 ATGCAAAAGGCAGGCCTGGATGG + Intronic
1053946054 9:43311341-43311363 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1053946192 9:43311983-43312005 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1055619981 9:78114985-78115007 AGGCAAAAAGCTGAACTGAATGG + Intergenic
1056364439 9:85889531-85889553 AGTCAAGAAGCTGGAGAGGACGG + Intergenic
1057541085 9:95971134-95971156 AGGTAAAAAACATGTGTGGAAGG + Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058399308 9:104595315-104595337 AGGCAAAAAACAGGTGTGCAGGG - Intergenic
1058554000 9:106147011-106147033 AGGCAAAAACAAGGTCTGGAAGG - Intergenic
1059213236 9:112534318-112534340 TGGCAAAAATGAGCAGTGGAAGG - Intronic
1059652306 9:116326204-116326226 AGGCAAAGAGCAGGTGTGGTTGG - Intronic
1061468765 9:130805563-130805585 AGAGAAAAAGTAGGAGGGGAAGG + Intronic
1061509268 9:131050445-131050467 GGGCAAAGAGCAGGAGCTGAGGG + Intronic
1061678635 9:132231822-132231844 AGGCTAGAAGCAGGAGAGGGTGG - Intronic
1061848414 9:133400849-133400871 AGGCAAAAGGCAGGCCTGGGTGG - Intronic
1062192820 9:135256473-135256495 AGGCAGAGGGCAGGAGGGGACGG - Intergenic
1062321057 9:135990764-135990786 AGGGAAAGGGCAGGAGGGGAGGG - Intergenic
1203589189 Un_KI270747v1:39921-39943 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1203589322 Un_KI270747v1:40541-40563 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1187393378 X:18900517-18900539 AGGCAGAGAGCAGGACTCGAGGG - Intronic
1187522194 X:20023509-20023531 AGGCAACGAGGAGGAGTGGTAGG + Intronic
1187647356 X:21363122-21363144 AGGCAAAAAGCAGGAAGCCATGG - Intergenic
1189439924 X:41026187-41026209 AGGCAAAAAGAAGGGGGAGAAGG + Intergenic
1190061511 X:47214737-47214759 GGGCAGAAAGCAAGAGAGGATGG - Intronic
1190212686 X:48460555-48460577 AGGCTGGAAACAGGAGTGGATGG - Intronic
1190990939 X:55549534-55549556 AGGCCAAAAGGAGGAGATGAAGG - Intergenic
1190994987 X:55598245-55598267 AGGCAAAAAGCATCAATAGAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192044549 X:67658340-67658362 AGGGAAAAAGAAGCAGAGGAAGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194168784 X:90556221-90556243 ATGGCAAAAGCAGGAGTGGTGGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195334869 X:103842566-103842588 ATTTATAAAGCAGGAGTGGAGGG + Intergenic
1195626900 X:107013212-107013234 AGGAAGGAAGCAGGAGTGGATGG - Intergenic
1196033991 X:111123042-111123064 AGGGAAAAAAAAGGAGTTGAGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197091096 X:122538677-122538699 TGGCAAAAAGCAGGTGTAGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1198384413 X:136114905-136114927 TGGAAATAAGCAGGAGGGGATGG - Intergenic
1198795602 X:140390913-140390935 AGGCAATAAGGAGGAGAGGATGG + Intergenic
1200083404 X:153590825-153590847 AGACAAAAAGCAGCAGTGGCTGG + Intronic
1200270504 X:154678201-154678223 GAGCACAAAACAGGAGTGGACGG - Exonic
1200515025 Y:4134007-4134029 ATGGCAAAAGCAGGAGTGGTGGG - Intergenic
1200982376 Y:9273892-9273914 AGGCAGATAGGAGGAGTAGAAGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic