ID: 1141706329

View in Genome Browser
Species Human (GRCh38)
Location 16:85667179-85667201
Sequence TCTACAAGGTGCACTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141706329_1141706333 -3 Left 1141706329 16:85667179-85667201 CCTTTGGCAGTGCACCTTGTAGA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1141706333 16:85667199-85667221 AGAGGCTTTTCTGTGGCCCTAGG 0: 1
1: 0
2: 3
3: 29
4: 284
1141706329_1141706331 -10 Left 1141706329 16:85667179-85667201 CCTTTGGCAGTGCACCTTGTAGA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1141706331 16:85667192-85667214 ACCTTGTAGAGGCTTTTCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 152
1141706329_1141706336 29 Left 1141706329 16:85667179-85667201 CCTTTGGCAGTGCACCTTGTAGA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1141706336 16:85667231-85667253 GCCTTATTCTGACCTTGTCCTGG 0: 1
1: 0
2: 2
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141706329 Original CRISPR TCTACAAGGTGCACTGCCAA AGG (reversed) Intronic
902184265 1:14713335-14713357 TCTACCAGGAGCATTGCAAAAGG - Intronic
905321999 1:37124474-37124496 TCTACAAGGTGGAATTCCTAAGG - Intergenic
909209764 1:72808407-72808429 TCTTCAAGCTGCACTGCCTGGGG + Intergenic
915878004 1:159633388-159633410 TCTACAAGGTTCAGTAACAAGGG - Intergenic
921937696 1:220810022-220810044 TTTACAAGGTGCAATGTAAATGG - Intronic
923497999 1:234541571-234541593 GCTACAAGGTGCCTTCCCAAGGG + Intergenic
923517914 1:234713084-234713106 TGTACAAAGTTCACTGCAAAGGG - Intergenic
1063694998 10:8326354-8326376 GCTACAAAATGCACTGCCAAGGG + Intergenic
1067788664 10:49271412-49271434 TCCACATCGTGCACTGCCCATGG - Intergenic
1076231935 10:128827396-128827418 TCTGCAAAATGCACTGCCAGTGG + Intergenic
1081889518 11:46529140-46529162 TGTCCAAGGTGCTCTGCAAAAGG + Intronic
1083395691 11:62390339-62390361 TCCCCAAGGAGCACTGCCACTGG + Intronic
1083709879 11:64541359-64541381 TCTGCAGGGTGCCCTGCCTAGGG + Intergenic
1090111156 11:123910855-123910877 GCTACAAGCTGCACTGCCTGGGG - Intergenic
1093471124 12:19503272-19503294 TCTACAAGGAGAACTACAAAAGG - Intronic
1096562640 12:52447690-52447712 ACTTTAAGGTGCACTGCCCAAGG - Intronic
1096566730 12:52488239-52488261 ACTTTAAGGTGCACTGCCCATGG - Intronic
1100200409 12:92292225-92292247 TTTACAAGGAACACTGCCAATGG + Intergenic
1100880059 12:99006506-99006528 TGTGCTAGGTGCAATGCCAAGGG + Intronic
1105532340 13:21231162-21231184 TCTCCAAGGTTCAGTTCCAATGG + Intergenic
1113365845 13:109675288-109675310 TCTATAATGTGCACCACCAACGG - Intergenic
1119169715 14:72525218-72525240 TCTACTAGGTGTACTCCCCAAGG - Intronic
1119701580 14:76759345-76759367 TCCATAAGGTGCTCTGCCAGAGG - Intergenic
1126685896 15:51248620-51248642 TCTAGAAGGTGAATTCCCAAAGG + Intronic
1130963297 15:88679308-88679330 TATCCAATGTGCACTGCCAGTGG - Intergenic
1135061570 16:19275487-19275509 ACAACCAGGTGCACTGCCCAAGG + Intergenic
1137807162 16:51318560-51318582 TCAGCAAGATGCAATGCCAATGG + Intergenic
1140060293 16:71563500-71563522 TTTAGAATATGCACTGCCAAAGG + Intronic
1141706329 16:85667179-85667201 TCTACAAGGTGCACTGCCAAAGG - Intronic
1143610464 17:8015044-8015066 TCTACAAGGTGCAGTGTGTAGGG + Exonic
1149092870 17:52804845-52804867 GCTACAAGCTGCACTGCCTGAGG + Intergenic
1155694578 18:28670222-28670244 TCTTCAAGAAGCACTGCCCAGGG + Intergenic
1156912440 18:42426487-42426509 GCTGCAAACTGCACTGCCAAGGG + Intergenic
1157908118 18:51587661-51587683 TGTACAAGGTGGATGGCCAAGGG + Intergenic
1158022529 18:52860033-52860055 TCTAGCAGGTGCATTGCCAATGG + Intronic
927436807 2:23073622-23073644 CCTACAAGGGGCAATGCCAATGG + Intergenic
935750895 2:106232914-106232936 GCTATAAGCTGCACTGCCTAGGG - Intergenic
937514172 2:122633663-122633685 TCTACAAGGTGAGCAGTCAAAGG + Intergenic
942391839 2:175503002-175503024 GCTGCAAGCTGCACTGCCTAGGG + Intergenic
944616486 2:201465542-201465564 GCTACAAGCTGCACTGCCTGGGG + Intronic
945133974 2:206605980-206606002 ACCACAAGGTGCACTACCACAGG - Intronic
948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG + Intergenic
948507348 2:238438017-238438039 TCTCCAAGGTGCAAAGACAAGGG - Intronic
1170919387 20:20662816-20662838 CAGACAAGGTGCACTTCCAAAGG + Intronic
1174547677 20:51337925-51337947 TGTGCAAGGGGCATTGCCAAAGG + Intergenic
1178126213 21:29518208-29518230 GCTGCAAGGTACACTGCAAAAGG + Intronic
1184074608 22:42168398-42168420 TCTAAACTGTCCACTGCCAATGG - Intronic
950291917 3:11791586-11791608 TCACCAAAGTGCACTGCCAGGGG - Intronic
957221426 3:77387829-77387851 TCTACAAGGTGCAGAACAAAAGG - Intronic
957515603 3:81247052-81247074 TCTACAAAGTGCATTACCTAAGG + Intergenic
963642358 3:147876442-147876464 TCTATGAGATGCACTGCAAATGG - Intergenic
963995910 3:151708735-151708757 GCTGCAAGCTGCACTGCCTAGGG - Intergenic
964113081 3:153107219-153107241 ACTAAAAAGTGCACTGCCACCGG + Intergenic
968434921 4:579480-579502 TCTAGAAGGAGCCCTGCCACTGG + Intergenic
969807848 4:9624653-9624675 TCTCTGAGGTGCACTGCCTAAGG - Intergenic
969829672 4:9784675-9784697 TCTGCAGTGTGCACAGCCAAGGG + Intronic
970175604 4:13336485-13336507 TCTCCAAGGTGCACTTCCTCAGG - Intergenic
972975191 4:44625591-44625613 TATAAAAGGTGTACTGTCAAAGG + Intronic
977490100 4:97700246-97700268 TGTACAAGCTGCTCTGCCACTGG - Intronic
994385959 5:99132158-99132180 TCAACAAGTTTCACTGCAAAGGG - Intergenic
1003390348 6:5707997-5708019 TCTCCAAGGTTCAATTCCAATGG - Intronic
1005146855 6:22701411-22701433 TCTACATGGTCCACTGGTAAAGG + Intergenic
1005665497 6:28049434-28049456 TCTATACAGTGCACTGCAAATGG - Intergenic
1010838754 6:80622974-80622996 GCTGCAAGGTGTACTGCCTAGGG - Intergenic
1011702197 6:89966338-89966360 TCTGCAATGGGCTCTGCCAATGG + Intronic
1014116565 6:117674133-117674155 TCTTCAGGCTGCACTGCCAAAGG + Intergenic
1014184391 6:118418671-118418693 TCTACAATGTTCTCTGCTAAAGG - Intergenic
1016054782 6:139567153-139567175 GCTGCAAGCTGCACTGCCTATGG + Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1018850622 6:167587878-167587900 TCTCCATGGTGCTCTGACAAGGG - Intergenic
1018940773 6:168307914-168307936 TCTCCACGGTGGACTGCCAGCGG + Exonic
1019979513 7:4610938-4610960 TCTAGAGTGTGCACTGCCCAAGG + Intergenic
1023974916 7:45021644-45021666 TCTGCAAACTGCACTTCCAAAGG - Intronic
1031066768 7:117113994-117114016 TCTTCAAGGTCAACAGCCAATGG - Intronic
1038926459 8:32145537-32145559 TGTACAAAGTGCCCAGCCAAGGG + Intronic
1039075738 8:33689260-33689282 TCCCCAAGCTGCACTGCTAAGGG - Intergenic
1050163040 9:2737689-2737711 GCTTCAAGGTTCACTACCAAAGG + Intronic
1055609727 9:78009271-78009293 CCAACAATGTGCACTGCCAGGGG + Intronic
1056342098 9:85646461-85646483 TCTACAATATGCATAGCCAATGG + Intronic
1057991125 9:99771029-99771051 ACTTCAAGGTGCTCTGCTAAAGG - Intergenic
1058522872 9:105829082-105829104 GCTGCAAGGTGCACTGCCTGGGG + Intergenic
1059493536 9:114690277-114690299 TCTACAAGCTGGAAAGCCAATGG + Intergenic
1059921557 9:119166274-119166296 GGAAGAAGGTGCACTGCCAAGGG + Intronic
1061814007 9:133182347-133182369 TTTCCAAGGAGCACTGCCCATGG - Intergenic
1185462981 X:340847-340869 TCTACGAGGAGCAGTGCCGAAGG - Exonic
1186720514 X:12298789-12298811 CCTAAAAGGTGCATGGCCAATGG + Intronic