ID: 1141706494

View in Genome Browser
Species Human (GRCh38)
Location 16:85668103-85668125
Sequence GGGCTTGCATCAGTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141706494_1141706501 0 Left 1141706494 16:85668103-85668125 CCCCAACACACTGATGCAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1141706501 16:85668126-85668148 TGTCCCCTCCACAGGGAGCGTGG 0: 1
1: 1
2: 1
3: 21
4: 194
1141706494_1141706497 -8 Left 1141706494 16:85668103-85668125 CCCCAACACACTGATGCAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1141706497 16:85668118-85668140 GCAAGCCCTGTCCCCTCCACAGG 0: 1
1: 0
2: 1
3: 28
4: 258
1141706494_1141706498 -7 Left 1141706494 16:85668103-85668125 CCCCAACACACTGATGCAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1141706498 16:85668119-85668141 CAAGCCCTGTCCCCTCCACAGGG 0: 1
1: 0
2: 2
3: 34
4: 340
1141706494_1141706506 30 Left 1141706494 16:85668103-85668125 CCCCAACACACTGATGCAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1141706506 16:85668156-85668178 GTCTGCAGAGCAGAACCACAAGG 0: 1
1: 0
2: 2
3: 26
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141706494 Original CRISPR GGGCTTGCATCAGTGTGTTG GGG (reversed) Intronic
901677768 1:10897004-10897026 GGGCCTGCATCAGTCTCTTTGGG + Intergenic
902881659 1:19375526-19375548 GGGTCTGCAACAGTGTGTAGTGG - Intronic
903741304 1:25560190-25560212 GGCCTTGAATCAGGATGTTGAGG + Intronic
903741308 1:25560212-25560234 GGCCTTGAATCAGGATGTTGAGG + Intronic
904308709 1:29611020-29611042 GGATTTGCAGCAGGGTGTTGGGG - Intergenic
906010891 1:42524504-42524526 GGGCTTGCAACAATGGGTGGAGG + Intronic
906100881 1:43260308-43260330 GGCCTTGCATCACTGTCCTGAGG + Intronic
906646052 1:47475993-47476015 GGGCATGCATCACAGTGATGAGG - Intergenic
906765639 1:48429232-48429254 GGGCTTGCAACAATGGGGTGAGG - Intronic
908180232 1:61596642-61596664 GGGCTTGCAACAATGTGGGGAGG - Intergenic
909668292 1:78160267-78160289 TGGCCTGCCTCACTGTGTTGGGG - Intergenic
911584396 1:99673782-99673804 GGGCTTGTATGTGTGTGTTTCGG - Intronic
911925774 1:103830647-103830669 GGCCTTGCAACAGTGTGAGGAGG + Intergenic
913266379 1:117049116-117049138 GGCCTTGCCTCAGTGTGGTGGGG - Intergenic
915815645 1:158962408-158962430 GGGGTGGCTCCAGTGTGTTGGGG - Intronic
915939477 1:160109628-160109650 GGGCTGGGAAAAGTGTGTTGAGG - Intergenic
917953316 1:180064195-180064217 GGGCTTGCAGTTGTGTGTGGGGG + Intronic
920532917 1:206717511-206717533 TGGCTTGCAGCAGTGGTTTGGGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923528664 1:234794858-234794880 GGGCTTGCATCTGTGATTTCTGG - Intergenic
1062821433 10:537208-537230 GGCCTTGCCTCTGTGTGGTGAGG - Intronic
1063869417 10:10401770-10401792 GGGTTTGCATCAGTGAGATGAGG - Intergenic
1064751832 10:18538140-18538162 GGGCTGGCATCAATGTGGTCTGG + Intronic
1065742162 10:28806800-28806822 GGGCTTGGTTCTGTGTGTTTGGG + Intergenic
1067087678 10:43251453-43251475 GGGCATGCGTGAGTGTGTTCTGG - Intronic
1068280714 10:54865344-54865366 GGACTTACATCAGTGGCTTGTGG + Intronic
1068359912 10:55964133-55964155 AGGCTCCCATAAGTGTGTTGAGG + Intergenic
1069174992 10:65279637-65279659 CTGCTTGCATCAGTGTGTCCTGG + Intergenic
1069667417 10:70172159-70172181 GGGCTTGCATCTGTGTCTCCAGG - Intergenic
1071823109 10:89297792-89297814 GTGCCTGCAGCAGTGTGTAGAGG - Intronic
1072856792 10:98955835-98955857 GTTCCTGCATCAGTGTGCTGAGG - Intronic
1074353865 10:112764088-112764110 GGTCGGGCATCAGTCTGTTGGGG - Intronic
1077467426 11:2740068-2740090 GGGCTTGCCTCTGTCTGTTCAGG - Intronic
1077544374 11:3162906-3162928 GGGAGTGCACCAGTGTGCTGGGG - Intronic
1079083157 11:17428033-17428055 GGGCTGGAATCAGTGTCTTTTGG - Intronic
1080571842 11:33564077-33564099 TGGCTTCCATCACTGTGTTTAGG + Intronic
1081348866 11:42024324-42024346 GCTCTTGCATCAGTTTGCTGAGG + Intergenic
1081655985 11:44857848-44857870 GGGCATGCATCTGTGTGTATCGG - Intronic
1082184824 11:49166039-49166061 CAGCTTGCTTCAGTTTGTTGTGG - Intronic
1083010001 11:59388019-59388041 TGGCTAGCCTCAGTGTGTTAGGG + Intergenic
1083647229 11:64179163-64179185 GTGCTTGGATCAGTGGGCTGGGG + Intergenic
1084801465 11:71547048-71547070 GGGCTGGCCTCAGTGACTTGAGG + Intronic
1085532305 11:77199112-77199134 GGGCTTGTAGCAGTGTCTTTGGG + Intronic
1089100114 11:115955946-115955968 TGGCTTGCAGCAGTGAGTAGTGG - Intergenic
1091706737 12:2698981-2699003 GGGCTTGCAGCAGTGGGGAGAGG - Intergenic
1095268082 12:40183476-40183498 GGGGTTCCATCAGTTGGTTGTGG - Intergenic
1097360424 12:58653734-58653756 TCTCTTGCATCAGTGTGATGTGG - Intronic
1100170545 12:91970435-91970457 GGCCTTGCCTCAGAGTGCTGTGG - Intergenic
1102685478 12:114721239-114721261 GAGCATGGATCCGTGTGTTGGGG + Intergenic
1103191237 12:119003708-119003730 GGGCTTGCTGCAGTGGCTTGAGG + Intronic
1107911284 13:45107894-45107916 GGGCAGGCATCAGTAAGTTGAGG + Intergenic
1108296325 13:49021654-49021676 AGGCTTGCAACAGTATGTTCAGG - Intronic
1111050958 13:82882887-82882909 CCCCTTGCATCAGTGTGTTCTGG + Intergenic
1114654034 14:24305278-24305300 GGGCTGTCATCAGTATGCTGGGG + Exonic
1115437814 14:33396061-33396083 GGGCTTGTTTCAAGGTGTTGTGG + Intronic
1116489537 14:45489945-45489967 TTTCTTGCATCAGTTTGTTGAGG - Intergenic
1121398435 14:93648823-93648845 GTGCTTGCATCTCTGTGCTGTGG - Intronic
1122190256 14:100036815-100036837 GGGCTTCAACCAGTGAGTTGTGG - Intronic
1202843961 14_GL000009v2_random:149533-149555 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1202913353 14_GL000194v1_random:139776-139798 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1202879298 14_KI270722v1_random:42913-42935 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1124565872 15:30813267-30813289 GGTCTTGCATGACTCTGTTGTGG - Intergenic
1124651291 15:31476235-31476257 GGGCTTGCCTCTGTGTGTACAGG + Exonic
1125465060 15:39942795-39942817 TGGGATGCAGCAGTGTGTTGTGG + Intronic
1126319791 15:47409790-47409812 GGGCTTGCATCAGATTTTTAAGG - Intronic
1128977841 15:72166557-72166579 GGTCTTGCACAAGGGTGTTGGGG - Intronic
1129612033 15:77068748-77068770 GTTCCTGCATCAGTTTGTTGAGG + Intronic
1129754786 15:78091492-78091514 GGTCTCACATCAGTGTGTGGTGG + Intronic
1131292937 15:91122845-91122867 GGGCTGGAGTGAGTGTGTTGGGG + Intronic
1132536227 16:482443-482465 GGCCTTGCAGCAGTGAGGTGTGG + Intronic
1132811276 16:1799023-1799045 GCTCTTGCATCAGTGTGATCTGG + Intronic
1133207320 16:4241349-4241371 GGGCTTGGCTCTGTGTGCTGAGG - Intronic
1136118343 16:28110647-28110669 GGGCTTGCATCCAGCTGTTGTGG - Intronic
1137982670 16:53083081-53083103 TGACTGGCAACAGTGTGTTGAGG + Intronic
1139846252 16:69923909-69923931 GGGCGTGTGTCTGTGTGTTGGGG - Intronic
1139901747 16:70333589-70333611 GGGCTGGCATCAGTGGCTGGTGG - Exonic
1139906837 16:70371993-70372015 GGGCTGGCATCAGTGGCTGGTGG - Exonic
1141439394 16:84019909-84019931 GGGGTTGCCTCAGTGTGTCCAGG - Intronic
1141706494 16:85668103-85668125 GGGCTTGCATCAGTGTGTTGGGG - Intronic
1146565660 17:33910806-33910828 GGGGTTACCTCAGGGTGTTGGGG + Intronic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1150815465 17:68389099-68389121 GTGCTCACATCAGTGTCTTGTGG + Intronic
1151167365 17:72216984-72217006 GGTCCTGCATCAGTCTCTTGGGG - Intergenic
1156461148 18:37322001-37322023 GTGCTTGCAGCAGCATGTTGTGG - Intronic
1158561437 18:58517024-58517046 GGCCGTGCATCACTGTGCTGCGG + Exonic
1158956623 18:62546373-62546395 GGGCTTGTAAAAGTGTGTGGCGG - Intronic
1162011534 19:7818909-7818931 TGGCTTGCATCACTGTGTAGGGG + Intergenic
1163248152 19:16110202-16110224 GGGCTTGCAGCTGGGTGTGGTGG - Intergenic
1164818199 19:31223087-31223109 GGGCTTCCATCAGTGTGACAGGG - Intergenic
1164900449 19:31916867-31916889 GGGATTGCATCAGGGTGTTTTGG + Intergenic
1165393564 19:35551695-35551717 TGCCTTGCATCAGAGTGTGGGGG + Intronic
1165993677 19:39830340-39830362 GGCCTTGGATCAGGGTGGTGGGG + Intronic
1202654915 1_KI270708v1_random:11921-11943 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
925059237 2:878372-878394 GGGCATGCATGTGTGTGTAGTGG - Intergenic
925059265 2:878527-878549 GGGCGTGCATGTGTGTGTAGTGG - Intergenic
925437537 2:3853417-3853439 GGGGTTCCATATGTGTGTTGGGG + Intergenic
926981959 2:18582359-18582381 GTGTTTCTATCAGTGTGTTGGGG - Intronic
928324704 2:30310255-30310277 GAGCTTGCAGCTGTGTGTGGTGG - Intronic
938155377 2:128934142-128934164 GGAATTGAACCAGTGTGTTGAGG - Intergenic
941071378 2:160958541-160958563 ATGCTTGCATCAGTGTGGTGGGG - Intergenic
941401199 2:165032955-165032977 GTGCATGCATGAGTGTTTTGAGG - Intergenic
944246248 2:197533238-197533260 GGGAGTGCTTGAGTGTGTTGGGG + Intronic
945965628 2:216183533-216183555 AGGACTGCATCTGTGTGTTGAGG + Intronic
946753223 2:222914642-222914664 AGGATTGCTTCAGGGTGTTGAGG + Intronic
1169891554 20:10458624-10458646 GTTCTTGCATTAGTTTGTTGAGG + Intronic
1171862880 20:30417678-30417700 GGCCTTGCACTACTGTGTTGAGG - Intergenic
1174728011 20:52884985-52885007 GGGGTTGCTTCATTGTTTTGTGG + Intergenic
1176423669 21:6534717-6534739 AGGCTTGCATCAGTGTTCCGGGG + Intergenic
1176632714 21:9154453-9154475 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1176640599 21:9300376-9300398 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1177068008 21:16464418-16464440 GGTCTTGCATCAGTGTGACATGG + Intergenic
1177471218 21:21563400-21563422 TGTCTTGCATCAGTGTGATCTGG - Intergenic
1179699162 21:43143032-43143054 AGGCTTGCATCAGTGTTCCGGGG + Intergenic
1180349622 22:11789759-11789781 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
1180388581 22:12202481-12202503 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1180763677 22:18229073-18229095 GGGCTTGCAGCAGTGGAGTGGGG + Intergenic
1180771967 22:18395470-18395492 GGGCTTGCAGCAGTGGAGTGGGG - Intergenic
1180803345 22:18645083-18645105 GGGCTTGCAGCAGTGGAGTGGGG - Intergenic
1180807474 22:18724874-18724896 GGGCTTGCAGCAGTGGAGTGGGG + Intergenic
1181218371 22:21350179-21350201 GGGCTTGCAGCAGTGGAGTGGGG + Intergenic
1181273348 22:21673596-21673618 GGGCTTACATCAGGGAGGTGTGG + Intronic
1182054499 22:27339391-27339413 GGGCCTGCCTCAGTGTGTGGGGG - Intergenic
1182432186 22:30305874-30305896 TGCCTTGTATCAGTGCGTTGAGG - Intronic
1183483849 22:38078959-38078981 GGGCTTGAATCAGAGGGTGGAGG - Intronic
1184703760 22:46196105-46196127 GGGCTGGGAACAGTGTGTTCAGG + Intronic
1203233805 22_KI270731v1_random:136460-136482 GGGCTTGCAGCAGTGGAGTGGGG - Intergenic
949356367 3:3184222-3184244 GTGCTTGCAGCACTGTGATGGGG + Intergenic
950774598 3:15338634-15338656 AGGCTTGCAGCAGTGTGGGGTGG + Intronic
951667993 3:25148185-25148207 AGGCTTACATCAATATGTTGGGG - Intergenic
952496380 3:33919483-33919505 GGGCTGGCACAAGTGTGATGAGG - Intergenic
953342825 3:42149987-42150009 GGGCTTGGAATAGTGTGTTCAGG + Intronic
954303507 3:49713742-49713764 GGGCCTGCATCAGTGAGTCTCGG - Exonic
954588024 3:51753760-51753782 GGGCTTGCAACAATGGGGTGAGG + Intergenic
954672040 3:52296409-52296431 GGGAATGCCTCAGGGTGTTGAGG + Intergenic
955733248 3:62009727-62009749 GTGCCTGCATCAGTGTGGAGAGG - Intronic
958054328 3:88389677-88389699 TGGCTTGCACTAGTGTATTGGGG + Intergenic
962132839 3:132700402-132700424 GGGAAAGAATCAGTGTGTTGGGG + Exonic
963908182 3:150791511-150791533 GGGGTTGCCTCTGTGTGTGGAGG - Intergenic
964072135 3:152647417-152647439 GCTCTTGCATCACTGTGCTGGGG + Intergenic
1202746294 3_GL000221v1_random:104648-104670 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
969330704 4:6472264-6472286 CGGATTGCATCGGTGTGTGGCGG - Intronic
970146089 4:13037615-13037637 GTTCTTGCATGAGTTTGTTGAGG - Intergenic
970288890 4:14550156-14550178 GTGCTTACAGCAGTCTGTTGCGG - Intergenic
971347834 4:25827597-25827619 GGGATTGCATTAGTTTGTTGGGG - Intronic
971479296 4:27099876-27099898 CAGCTTGCAGCAGTGTGTTATGG - Intergenic
972689371 4:41381858-41381880 GGGGTTGGATCATTGTGTTTTGG + Intronic
975493374 4:75012517-75012539 GTGTCTGCATCAGTGTTTTGTGG - Exonic
982473154 4:155818413-155818435 GGTCTTGCTTCAGTGTATTAGGG - Intergenic
985370563 4:189281528-189281550 GGCCTTGCACTACTGTGTTGGGG + Intergenic
1202755495 4_GL000008v2_random:58644-58666 GGGTATGCCTCAGTTTGTTGAGG - Intergenic
985891953 5:2723077-2723099 GGGGATGCACCTGTGTGTTGTGG - Intergenic
990553532 5:56908581-56908603 GTGCATGCATCTGGGTGTTGGGG + Intergenic
991123563 5:63044340-63044362 GAGCTTGCATCAGAGTTTTCTGG - Intergenic
992083231 5:73254794-73254816 GGGTTTGCCTCAGTGGGGTGAGG - Intergenic
995600051 5:113786087-113786109 GGCCCTGCATCAGTGTGTCTTGG + Intergenic
996026955 5:118657247-118657269 GCCCTTGCATCAGTGTGGTCTGG - Intergenic
996407093 5:123116240-123116262 GGGATTTCATCACTGTGTGGAGG - Intronic
998756882 5:145390986-145391008 TTTCTTGCATCAGTGTGATGTGG - Intergenic
1002599925 5:180348287-180348309 GGGCCTGCCTGTGTGTGTTGGGG + Intronic
1005729757 6:28685467-28685489 GGGAATGCCTCAGTTTGTTGTGG - Intergenic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1019159208 6:170058027-170058049 CGGCTGGCATCCGTCTGTTGGGG - Intergenic
1019911100 7:4100936-4100958 GGGCAGGCCTCAGGGTGTTGTGG - Intronic
1020349948 7:7208628-7208650 GGGCTTGCATCAGTGGGTGGAGG + Intronic
1021445749 7:20731829-20731851 GGGCTTGGATGAGTGTGAAGAGG - Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1025064393 7:55840706-55840728 GCATTTGCATCAGTGTGTTAGGG - Intronic
1027232812 7:76282208-76282230 GGGCTGGGATCAGTGTGGGGAGG - Intronic
1033347200 7:140534691-140534713 GGGCTTGCTGCAGAGTGTGGAGG + Intronic
1034431690 7:151044236-151044258 GGGCGTGGATCAGTGGGTTGAGG + Intronic
1035070384 7:156140373-156140395 GGGCTTGCATTAGTTTTTTTGGG - Intergenic
1035164897 7:156981237-156981259 GGGCATGGATCAGTTGGTTGGGG + Intergenic
1037023789 8:14007087-14007109 CTGCTTGCATCAGTGTGTGATGG + Intergenic
1039495414 8:37976480-37976502 GGGCTTGCATCTGTGAGTGGGGG - Intergenic
1039960946 8:42247220-42247242 GGCCATGCATCAGCGTGTTTTGG + Intergenic
1040749009 8:50682742-50682764 GGGCATGCCTGAGGGTGTTGGGG - Intronic
1042184428 8:66122628-66122650 GGGCATCCATCAGTGAGTTGGGG - Intergenic
1043002785 8:74780018-74780040 GGCCATGCATCAGTTGGTTGGGG - Intronic
1045357883 8:101405424-101405446 GGGTTTGCTTGAGAGTGTTGAGG - Intergenic
1045370070 8:101514438-101514460 GGGCTTGCCTCAGAGTCTGGGGG - Intronic
1046090949 8:109502078-109502100 GGCCTTGAATGAGTGTGGTGTGG - Intronic
1046514631 8:115242244-115242266 GGGCATGTGTCAGTGTGGTGAGG + Intergenic
1047328035 8:123858651-123858673 GTGATTGCATCACTGAGTTGTGG - Intronic
1047519383 8:125582846-125582868 GTGCTAGCATCAAAGTGTTGGGG - Intergenic
1048962728 8:139593904-139593926 GGGCTGTCATCAGTGAGGTGAGG + Intergenic
1049648893 8:143754189-143754211 GGGCTTGCAGCAATGTGGGGAGG + Intergenic
1054799718 9:69335320-69335342 GGGCTTCCATGAGTGTGGAGCGG + Intronic
1056754684 9:89374272-89374294 GGGCTTGCAGCAGTGTGGCCAGG - Intronic
1057193754 9:93102799-93102821 GTGCTTGCAGCAATGTTTTGTGG + Intronic
1057324099 9:94044547-94044569 TGGCCTGCATCAGTTTGCTGAGG + Intronic
1060052713 9:120388497-120388519 GGGCTTGGATCAGAGGGTAGTGG + Intergenic
1061596289 9:131631535-131631557 GGGCCTGCATGTGTGTGATGAGG + Intronic
1203755547 Un_GL000218v1:122076-122098 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1203446215 Un_GL000219v1:58737-58759 GGCCTTGCACTACTGTGTTGGGG + Intergenic
1186397202 X:9222083-9222105 GGGCTTTCAAGAGTGTGTGGGGG - Intergenic
1187580043 X:20597537-20597559 GTGCATGCATGAGTGTGTGGAGG - Intergenic
1189070367 X:37857078-37857100 CGCCTTGCATCAGTGTGCTCTGG - Intronic
1189719919 X:43905487-43905509 GGGCTTACAGCAGTGACTTGAGG + Intergenic
1195596473 X:106696923-106696945 GGGCTTGCTTATGTGTTTTGGGG + Intronic
1195703108 X:107719679-107719701 AGGCTTGAATGAGTGAGTTGAGG + Intronic
1196664144 X:118298654-118298676 GGGTATGCCTCAGTTTGTTGAGG + Intergenic
1197956788 X:131959443-131959465 GGTCTTCCAGCAGTGTTTTGTGG - Intergenic
1201169157 Y:11239681-11239703 GGGTATGCCTCAGTTTGTTGAGG + Intergenic