ID: 1141707613

View in Genome Browser
Species Human (GRCh38)
Location 16:85676571-85676593
Sequence GCAGCATGCTAGACACTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141707607_1141707613 22 Left 1141707607 16:85676526-85676548 CCTGCCTGGCGGGGACACGTGGG 0: 1
1: 1
2: 3
3: 14
4: 166
Right 1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG 0: 1
1: 1
2: 1
3: 23
4: 159
1141707609_1141707613 18 Left 1141707609 16:85676530-85676552 CCTGGCGGGGACACGTGGGCAGC 0: 1
1: 1
2: 2
3: 12
4: 168
Right 1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG 0: 1
1: 1
2: 1
3: 23
4: 159
1141707605_1141707613 28 Left 1141707605 16:85676520-85676542 CCAAAACCTGCCTGGCGGGGACA 0: 1
1: 0
2: 2
3: 4
4: 97
Right 1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG 0: 1
1: 1
2: 1
3: 23
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141707613 Original CRISPR GCAGCATGCTAGACACTGGA GGG Exonic
902707527 1:18215952-18215974 GCATAATGCTTGACACAGGATGG - Intronic
902958227 1:19941605-19941627 GCATCATTCTAGGCACTGGCGGG - Intergenic
903138328 1:21323732-21323754 GCAGCATGTTAGACTGTGGGAGG + Intronic
906232124 1:44172605-44172627 GCAGCCTGCTAGAGACTGCCTGG - Intergenic
907502157 1:54888492-54888514 GCACCGTGCTAGAAGCTGGAAGG - Intergenic
908254855 1:62294795-62294817 GCAGCATGCCAGCCAGAGGAAGG + Intronic
913048222 1:115090963-115090985 GCAACATGGTAGAAACTGAATGG - Intergenic
913214202 1:116606819-116606841 GCACCATGCTAGGCATTGCAGGG + Intronic
913327121 1:117636969-117636991 GCAGCTTCCTAGACAGTGGAAGG - Intergenic
916792815 1:168138152-168138174 GCGGCAAGCCAGACACTTGAAGG + Intergenic
918577177 1:186076461-186076483 GAAACATGCTAGATACTGGCAGG + Exonic
923209742 1:231792812-231792834 GGAGAATGCTAGACTCTGGCTGG - Intronic
924371171 1:243351330-243351352 CCAGTATGCTAGACACTGTGGGG + Intronic
1066483539 10:35822160-35822182 GCACTGTGCTAGATACTGGAAGG + Intergenic
1067299415 10:44995269-44995291 GAAGAAGGCCAGACACTGGAAGG + Exonic
1067408981 10:46048284-46048306 GCACCCTGCTGGTCACTGGAAGG - Intergenic
1067921045 10:50457992-50458014 GCAGCATGGTAAGCACTGGGTGG + Intronic
1068924215 10:62517950-62517972 GCCCCATGCTAAACACTGCAAGG - Intronic
1069782338 10:70964835-70964857 GGGTCTTGCTAGACACTGGAGGG - Intergenic
1070634048 10:78109562-78109584 GCAGCAGGACAGACCCTGGAAGG + Intergenic
1074296000 10:112190212-112190234 TCAGCATGCGATACACTGGTAGG - Intronic
1074420856 10:113307860-113307882 GCAGCATGTGTGAAACTGGAGGG - Intergenic
1074837582 10:117312546-117312568 CCAGCATGCTAGACACTTGCTGG - Intronic
1076110146 10:127853988-127854010 CCAGCATGTGAGACGCTGGAGGG - Intergenic
1078132560 11:8624808-8624830 GCTGCATGTCAGAAACTGGAGGG + Exonic
1078182722 11:9026197-9026219 GCAGCATGCTAGGCAATTTATGG + Intronic
1079125664 11:17717148-17717170 GGAGCATGCTGGTTACTGGAGGG - Intergenic
1080413765 11:32050768-32050790 GGAGGATGCTAGACCATGGAGGG - Intronic
1082561400 11:54624688-54624710 CCACCAAGCTAGGCACTGGAGGG + Intergenic
1084429673 11:69104230-69104252 GCCGCATGCTAGGCATTGGGAGG + Intergenic
1084980313 11:72825348-72825370 GCAGCCTCCTGGCCACTGGAGGG + Exonic
1089760709 11:120721048-120721070 TCAGGGTGCTACACACTGGAGGG + Intronic
1089900061 11:121972628-121972650 GCAGCCTTCCAGACAGTGGAAGG + Intergenic
1090403162 11:126461673-126461695 TCAGGATTCTAGACACTGGCTGG + Intronic
1091891057 12:4054943-4054965 GCAGCATGCTAGATGCTGGGAGG + Intergenic
1097104881 12:56616241-56616263 GCAGAATGCAAGTCACTGTAGGG - Intronic
1098477719 12:70924465-70924487 GCAGCAGGCAAGAAACTGGTGGG + Intergenic
1100288042 12:93186460-93186482 GAAGCTTGCTAGACACTAGAAGG - Intergenic
1104628423 12:130378882-130378904 ACAGCAAGCCAGAAACTGGAAGG - Intergenic
1105217418 13:18297372-18297394 GCACCATGCTAGGCATTGCAGGG + Intergenic
1108077354 13:46695105-46695127 GCAGCAAGCTGGACATTGAAGGG - Intronic
1109227349 13:59713088-59713110 GCAGCATGTTAGGAACTGGGTGG - Intronic
1111445297 13:88339595-88339617 GGAGCCTGCTTGAGACTGGATGG - Intergenic
1112462013 13:99611047-99611069 GCAGCATGGCAGCCACTAGAGGG - Intronic
1112994896 13:105561530-105561552 ACAGCATTCTAGACTCTAGAAGG - Intergenic
1114479069 14:23020227-23020249 ACAGCATGCTAGACACTGTGGGG + Intronic
1122288433 14:100666592-100666614 GCAGCATTCTAGTCCTTGGATGG - Intergenic
1122578696 14:102757739-102757761 GCCACCTGCTAGACACGGGATGG - Intergenic
1129952412 15:79603678-79603700 GCCACATGCTAGACACTGCGAGG - Intergenic
1132157398 15:99505301-99505323 GCAGCCTGCTGGGCACAGGAAGG + Intergenic
1134805429 16:17120132-17120154 GCACTATGCTAGGCACTGGAGGG - Intronic
1137837091 16:51602816-51602838 GAAGAGTTCTAGACACTGGAAGG - Intergenic
1139348641 16:66321449-66321471 GCACCATGCTAGACACAGGGAGG + Intergenic
1139784222 16:69378279-69378301 GCAGCAGGACAGACAGTGGAAGG + Intronic
1141707613 16:85676571-85676593 GCAGCATGCTAGACACTGGAGGG + Exonic
1142279710 16:89141511-89141533 GCAGCAGGATGGACCCTGGAGGG + Intronic
1146295368 17:31645657-31645679 GGAGCATGCTAGGCAGTGGGAGG + Intergenic
1151621947 17:75251249-75251271 TCAGCATGCCAGACCCTGGAGGG + Intronic
1156474215 18:37395379-37395401 GCAGCTTGCAAGAGCCTGGAAGG - Intronic
1158879125 18:61759800-61759822 GAAGCAACCTAGACACTGAAAGG + Intergenic
1159059602 18:63500793-63500815 GGAGCAAGCTGGAGACTGGATGG - Intronic
1160040114 18:75337516-75337538 GCAGCAGGCTGGACCCTGGTTGG - Intergenic
1164878049 19:31706673-31706695 GCCCCATGCTGGACACAGGAAGG + Intergenic
1167293601 19:48637119-48637141 GCAGCGTTCTGGATACTGGAGGG - Exonic
1168408498 19:56123303-56123325 GGAGCCAGCTAGACACTGGATGG + Intergenic
925218268 2:2116177-2116199 GCAGCATTCCAGTCCCTGGATGG - Intronic
925701855 2:6646871-6646893 GGAGGATGCTAGACACTGGAGGG - Intergenic
925917802 2:8619263-8619285 GCAGCATGGTCCACTCTGGAAGG + Intergenic
931900941 2:66787364-66787386 GCAGAATGGTAGATACTGCATGG + Intergenic
934296902 2:91749311-91749333 GCACCATGCTAGGCATTGCAGGG - Intergenic
934756783 2:96829882-96829904 ACACCATCCTAGACACTAGAAGG + Intronic
935708366 2:105876086-105876108 ACAGCATGCCAGCCATTGGAAGG + Intronic
936067209 2:109341713-109341735 GCTGCATGGTAGACACAGTAGGG - Intronic
936757565 2:115733342-115733364 GCAGCATGGGAGTCACAGGAAGG + Intronic
937555841 2:123154584-123154606 GTAACATGCAAGACAATGGATGG + Intergenic
941319431 2:164036253-164036275 GCAACATTCTAAAAACTGGAGGG + Intergenic
942921869 2:181383884-181383906 ACAGCATGGCAGCCACTGGAGGG + Intergenic
946173700 2:217910093-217910115 GCACCATGCCAGACCCAGGAGGG - Intronic
946768516 2:223062813-223062835 GGAGCATGCAAGGCACTAGATGG + Intronic
947109760 2:226706297-226706319 GCAACTTCCTAGACACAGGAAGG + Intergenic
947139501 2:227008266-227008288 GCAGCGTGCTAAATACGGGAAGG + Exonic
947266785 2:228291324-228291346 GCAGGATGCTATACACAGGTAGG + Intergenic
948137557 2:235648140-235648162 GCAGCATGGCACACACGGGATGG - Intronic
1169003111 20:2182633-2182655 GCAGAATGAGAGACATTGGAAGG + Intergenic
1169060909 20:2659805-2659827 GGGGCAGGCTAGACACTGGGAGG + Intronic
1169962202 20:11173673-11173695 ACAGCATGTAAGACATTGGAAGG - Intergenic
1169975710 20:11324997-11325019 GCAGAATACCAGAGACTGGATGG - Intergenic
1172369122 20:34373592-34373614 GCTGTATGCTAGACATTGCAGGG + Intronic
1172908275 20:38385896-38385918 GCAGCCTGCCACACAGTGGAGGG - Intergenic
1179468299 21:41593067-41593089 GCTGCATGAGAGACAGTGGATGG + Intergenic
1181505325 22:23352261-23352283 ACAGCATTTTGGACACTGGAAGG - Intergenic
1182091767 22:27600660-27600682 GCTGCATGCTAGAAACTAGCTGG - Intergenic
1182994006 22:34796292-34796314 ACAGTATGCCAGACACTGTATGG + Intergenic
1183904721 22:41031864-41031886 TCACCATGCTAGGGACTGGAGGG - Intergenic
1184044190 22:41962284-41962306 GCACAATGCCAGACACTGGCAGG - Intergenic
1184441483 22:44519327-44519349 GCAGCTTCCTAGACACTGGCTGG + Intergenic
950845011 3:16006794-16006816 GCAGCCTAATAGACACTGGAGGG - Intergenic
953018146 3:39097759-39097781 TCACCATGCTAGTCACAGGAGGG - Exonic
953152534 3:40337939-40337961 GCTGGTTGCTAGGCACTGGAAGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955323208 3:57989749-57989771 GCAGGATGCCAGGCCCTGGAGGG - Intergenic
955926680 3:64013052-64013074 GCAGCAACCTAAAAACTGGAAGG + Intronic
957652600 3:83028117-83028139 TCAGCATGCTAGACACTGATAGG - Intergenic
959012355 3:101092675-101092697 GCAGCCTGGAAGCCACTGGATGG + Intergenic
959619852 3:108388231-108388253 GGAGGATGCCAGACCCTGGAGGG + Intronic
961546759 3:127639623-127639645 GCAGCATGGTAAAAACTGTAGGG - Intronic
961625535 3:128260641-128260663 GTAGCATGCCAGGCACTGAAAGG - Intronic
962654064 3:137524649-137524671 GCACTATTGTAGACACTGGAGGG + Intergenic
962757215 3:138474426-138474448 GCAGCCTGCCAGATGCTGGAAGG + Intronic
964515587 3:157504345-157504367 GCAGCATGATTGCCACTGAATGG - Intronic
966126557 3:176583759-176583781 GCAGCATAGAAGCCACTGGAAGG + Intergenic
966710503 3:182967706-182967728 GAAGAATCCTAGACACTTGAGGG - Intronic
966837187 3:184058419-184058441 GCAGCATGCTGTCCACTGGAAGG - Exonic
967714726 3:192749377-192749399 GCAGCATTTTAGACAGTGGGTGG - Intronic
967727832 3:192878643-192878665 GCAACATGCTAGCCATGGGATGG + Intronic
967899439 3:194434459-194434481 GCACTATGCTAGTCACTGGGAGG + Intronic
968260104 3:197314758-197314780 GCAGTATGCTGGGAACTGGAAGG - Intergenic
968288632 3:197522549-197522571 GCAGGATGCCAGCCAGTGGAAGG + Intronic
969201158 4:5607424-5607446 GCAGCCTGGAAGACATTGGAGGG - Intronic
969277064 4:6143017-6143039 GCAGCCTGGTGGACTCTGGAAGG + Intronic
972653782 4:41046793-41046815 GCAGCATGCAACACCCTGGCAGG + Intronic
972985652 4:44761275-44761297 GCACCAGGCTAGAAAATGGAGGG - Intergenic
973771053 4:54207111-54207133 GGACCATGCTAGGCACTGGAGGG + Intronic
977801702 4:101242230-101242252 GCATCATATTAGACACTGAATGG + Intronic
979358929 4:119738828-119738850 GCATCATGCTTTACACTGCAGGG - Intergenic
987579287 5:19768045-19768067 GCAGCCTGGTAGCCACTGGAGGG + Intronic
987848796 5:23322759-23322781 GCAACAGGCTGGAAACTGGAAGG + Intergenic
991207379 5:64065507-64065529 GGAAAATGCAAGACACTGGAAGG + Intergenic
991705799 5:69357161-69357183 GCAGTCTGATGGACACTGGAGGG + Intronic
992311727 5:75508606-75508628 GCAATATGCTAGACACTGCAGGG + Intronic
992953561 5:81885063-81885085 ACAGCATGCTGGGCACTTGAGGG - Intergenic
993856947 5:93087927-93087949 GAAGCATGCATGATACTGGAGGG - Intergenic
995246912 5:109945227-109945249 TCAGCATTCTAGGCACTGAAAGG + Intergenic
995955674 5:117773488-117773510 GCAGCATGCTACACACTGGAGGG - Intergenic
996304421 5:122030396-122030418 GCAGCCTGGCAGCCACTGGAGGG + Intronic
997266565 5:132498242-132498264 GCAGCCAGCTAGCCAGTGGAAGG + Intergenic
997440817 5:133907498-133907520 GCAGCATGCTAAACAGATGAAGG + Intergenic
1002719284 5:181247855-181247877 CCAGCATTCCAGACCCTGGAGGG + Intronic
1003626013 6:7741930-7741952 GCACCATGCTAGGCACTTGGGGG - Intronic
1003904111 6:10683101-10683123 TCAGCTTGCTAGAAACTGGAAGG - Intronic
1004425048 6:15501474-15501496 GGAGCGTGCTATGCACTGGACGG + Intronic
1004843221 6:19610920-19610942 GGATCCTGGTAGACACTGGATGG - Intergenic
1007356235 6:41319691-41319713 TCAGCATGCTACACCCTCGAGGG + Intergenic
1008248024 6:49203214-49203236 GCAGCCTGGAAGCCACTGGAGGG - Intergenic
1013581593 6:111540263-111540285 GCACTATGCTAGGCACTGCAGGG - Intergenic
1013709579 6:112880760-112880782 GCAAAATGCTACAGACTGGATGG - Intergenic
1016721459 6:147303658-147303680 GCAGCTTCCTAGAGACTTGAAGG + Intronic
1018440370 6:163806931-163806953 CCAGCAGGCTAGAGTCTGGAAGG + Intergenic
1019103275 6:169649440-169649462 GTAGCATGAGAGACACAGGAGGG - Intronic
1021901585 7:25290901-25290923 GCTGCCTCCTATACACTGGAAGG - Intergenic
1022302099 7:29111387-29111409 GCACCAAGCAAGACACTGGAGGG + Intronic
1022312818 7:29213073-29213095 GCAGCCTCCAAGTCACTGGAAGG - Intronic
1023982047 7:45076049-45076071 TCAGCATGATGGACAGTGGATGG + Exonic
1024248313 7:47487325-47487347 AAAGCATGCTTGACACTTGAGGG - Intronic
1027465472 7:78509641-78509663 GCAACATGTTAGATACTGGCAGG - Intronic
1027502766 7:78974771-78974793 ACAGTATCCTAGACACTGTATGG + Intronic
1029454321 7:100660522-100660544 GCACCATGCTAGACATAGGAGGG + Intergenic
1033921564 7:146399335-146399357 GCTGCATACCAGAGACTGGAGGG - Intronic
1034423064 7:150999232-150999254 GCAGCATGTTGGACACTGCCGGG - Exonic
1035263392 7:157675450-157675472 GCAGAATTCAAGACACTTGATGG - Intronic
1038529261 8:28304389-28304411 GCAGAATGCTACAGACTGGGTGG + Intergenic
1039139301 8:34367636-34367658 GCAGCTTGCCAGTCACTGAAAGG - Intergenic
1040487023 8:47883411-47883433 GCACCATGCTGGACACTCCATGG + Intronic
1046592187 8:116220278-116220300 GTACTATGCTATACACTGGAAGG - Intergenic
1047167725 8:122459019-122459041 CCACCATGCTAGAAAGTGGAGGG + Intergenic
1048490941 8:134893209-134893231 GCAGCCTGCAAGCCACTGGAAGG - Intergenic
1055245518 9:74237680-74237702 GCATTATCCTAGACACTGGAAGG - Intergenic
1055429947 9:76233234-76233256 CCAGCATGCCAGAAACTGGCTGG - Intronic
1056903617 9:90625086-90625108 GCAGCATGCTAACCTCTGCAGGG + Intronic
1057657991 9:96972911-96972933 GCAGCATGGTACACACTTGGTGG + Exonic
1057787222 9:98096198-98096220 GCAGCATGCTGTACATTGGGAGG + Intronic
1059569813 9:115422846-115422868 GCATTATGCCAGACACTGCATGG - Intergenic
1059753994 9:117275357-117275379 ACAGCATACTAAAAACTGGATGG + Intronic
1059795150 9:117686547-117686569 GCAGCAAGAAAGACACTTGATGG - Intergenic
1060722394 9:125987671-125987693 GCAGCATGCAAGACTGTGGGGGG - Intergenic
1062173626 9:135148883-135148905 GCAGCAAGCTGGACACTAGAGGG + Intergenic
1186382226 X:9072921-9072943 GAAGCATGCAACACAATGGAAGG + Intronic
1187438457 X:19294519-19294541 GCAGCATGGTGGATACTGGAGGG - Intergenic
1187887405 X:23902445-23902467 GCATCATGCTGGACCCTGGTGGG - Intronic
1192268755 X:69558720-69558742 CCAGCTTGCAAGACACTTGAGGG - Intergenic
1193630922 X:83887281-83887303 GCAGGGTGCTAGTCAGTGGATGG - Intergenic
1193891178 X:87047617-87047639 GCAGCCTGGCAGCCACTGGAGGG + Intergenic
1195914478 X:109922645-109922667 GCACTGTGCTAGACACTGGGAGG - Intergenic
1197924642 X:131633712-131633734 GCATCATGCTGAACACTAGAGGG - Intergenic
1201414543 Y:13735102-13735124 GAAGCATGGTTGACACTGGTGGG + Intergenic