ID: 1141709496

View in Genome Browser
Species Human (GRCh38)
Location 16:85689530-85689552
Sequence CCGGGCCCGGTGCTGAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141709496_1141709510 16 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709510 16:85689569-85689591 GGCTGACAGATAGAGGGATGAGG 0: 1
1: 0
2: 1
3: 25
4: 315
1141709496_1141709511 17 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709511 16:85689570-85689592 GCTGACAGATAGAGGGATGAGGG 0: 1
1: 0
2: 2
3: 27
4: 275
1141709496_1141709506 9 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709506 16:85689562-85689584 TCACCCGGGCTGACAGATAGAGG No data
1141709496_1141709502 -6 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709502 16:85689547-85689569 GCCCGGGACTAGGCATCACCCGG 0: 1
1: 0
2: 0
3: 4
4: 77
1141709496_1141709504 -5 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709504 16:85689548-85689570 CCCGGGACTAGGCATCACCCGGG 0: 1
1: 0
2: 0
3: 3
4: 105
1141709496_1141709507 10 Left 1141709496 16:85689530-85689552 CCCAAACTCAGCACCGGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1141709507 16:85689563-85689585 CACCCGGGCTGACAGATAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141709496 Original CRISPR CCGGGCCCGGTGCTGAGTTT GGG (reversed) Intronic
900489808 1:2942202-2942224 CAGGGCCAGGGGCTGAGTTTTGG + Intergenic
900583075 1:3418865-3418887 CAGGGCCGGGTGCTGAATTCTGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901079245 1:6574555-6574577 CCTGGCCCTGTGCTGGGTGTGGG - Intronic
903568957 1:24290195-24290217 CCAGGCCCTGTGCTGAGTATGGG - Intergenic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
915937499 1:160098052-160098074 CCAGGCCTGGAGCTGAGTGTGGG + Intronic
919091128 1:192979860-192979882 CCGTGACCGGCGCGGAGTTTTGG + Intergenic
920611165 1:207439207-207439229 CTGGGCCCTGTGCTGAGTCTTGG - Intergenic
921611902 1:217222332-217222354 CCAGGCCTGGTGATGAGTCTGGG + Intergenic
923000823 1:230005100-230005122 CTGGGCCCTGTGCTGAGTGTTGG - Intergenic
923487916 1:234453850-234453872 CCAGGCACTGTGCTGAGTGTTGG - Intronic
923726170 1:236507230-236507252 TCAGGCCCAGTGCTGAATTTTGG + Intergenic
1069954498 10:72041742-72041764 CCAGGCCCTGTGCTGGGTGTTGG - Intergenic
1077117872 11:893468-893490 CCGGGCCTGGTGCAGAGCCTCGG + Exonic
1077369349 11:2174297-2174319 CCAGGCCAGGTGCTGAGGCTGGG + Intergenic
1077727161 11:4686104-4686126 GCAGGCACTGTGCTGAGTTTAGG + Intronic
1083248029 11:61445079-61445101 CCAGGCCCTGTGCTGAGTAAGGG + Intronic
1083782295 11:64924843-64924865 CCCGGCCCGGGGCTGAGTTGGGG + Exonic
1084855599 11:71983653-71983675 CCAGGCCCTGTGCTGAGTGCTGG + Intronic
1085003649 11:73063912-73063934 CTTGGCCCAGAGCTGAGTTTAGG - Intronic
1085084321 11:73656631-73656653 CCAGGCCCTGTGCTGAGTTCTGG - Intronic
1085521251 11:77140185-77140207 CCAGGCCCTGTGCTGGGTTGAGG + Intronic
1089759817 11:120715166-120715188 CTGGGCCAGGTGCTGGGATTCGG + Intronic
1092252800 12:6910259-6910281 CCAGGCCTTGTGCTGTGTTTTGG + Intronic
1096002457 12:48141088-48141110 CCAGGCACTGTGCTGAGCTTTGG - Intronic
1097413242 12:59282060-59282082 CCAGGCACAGTGCTGAATTTTGG + Intergenic
1098270146 12:68762119-68762141 CCCAGCCAGGTGCTCAGTTTTGG + Intronic
1102467462 12:113138181-113138203 CCGGGCCATGTGCAAAGTTTGGG - Intergenic
1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG + Intronic
1103749961 12:123151518-123151540 CCGCGCCCGGGGCTGGGCTTCGG - Intergenic
1105202295 13:18190889-18190911 CCGGGACTGGGGCTGAGCTTGGG + Intergenic
1109270782 13:60252873-60252895 CCAGGCCTTGTGCTGAGTATTGG - Intergenic
1113552463 13:111203950-111203972 CCGGCCCCTGTGCTGGGTGTTGG + Intronic
1121331234 14:93051027-93051049 CCGGGCCCTGTGCTGAGCACTGG - Intronic
1122384350 14:101333811-101333833 CCGGGCATGGTGCTGACTTGGGG - Intergenic
1131537258 15:93247824-93247846 CCCAGCCTGGTGCTGCGTTTGGG + Intergenic
1134493354 16:14712355-14712377 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1134498735 16:14751479-14751501 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1134581838 16:15377606-15377628 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1134619666 16:15678019-15678041 CTGGGCCCTGTGCTGAGTATAGG + Intronic
1135312767 16:21418968-21418990 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1135365684 16:21851238-21851260 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1135446124 16:22519914-22519936 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1136168145 16:28470523-28470545 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1136211169 16:28758597-28758619 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1136309442 16:29397727-29397749 CCGGGCCCGGATCTGAGTTGGGG + Intronic
1136322884 16:29499482-29499504 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1136437568 16:30239450-30239472 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1137586052 16:49664544-49664566 CAGGGCCTGGTGCTGAGGCTGGG + Intronic
1138650630 16:58458980-58459002 CCAGGCCCTGTGCTGAGCTCAGG - Intergenic
1141634539 16:85307054-85307076 CTGGGCCAGCAGCTGAGTTTGGG + Intergenic
1141709496 16:85689530-85689552 CCGGGCCCGGTGCTGAGTTTGGG - Intronic
1141939279 16:87263878-87263900 CCGGGGCTGGTGCTGACTCTAGG - Intronic
1142086284 16:88184195-88184217 CCTGGCACGGAGCTGAGTTAGGG - Intergenic
1142355406 16:89599322-89599344 CCGGGCCCTGTGCTGATTGGGGG + Intergenic
1142668681 17:1477376-1477398 CCAGGGACGGTGCTGAGTTAAGG - Intronic
1142958280 17:3535539-3535561 CCCCGCCCGGTGCGGAGTCTGGG - Intronic
1144930145 17:18852384-18852406 CCAGGCCCAGTGCTGAGGGTTGG - Intronic
1145229919 17:21166092-21166114 CAGGGCCCGGGGCTGGGCTTTGG + Intronic
1145823013 17:27854808-27854830 CCGGGCACAGTGCTGGGCTTCGG + Intronic
1149951757 17:60995778-60995800 CCAGGCACTGTTCTGAGTTTAGG + Intronic
1150358175 17:64506065-64506087 CCGGGACCGAGGGTGAGTTTGGG - Exonic
1152519278 17:80845862-80845884 CCTGGCCCGGTGCTGGTTTGTGG + Intronic
1152925358 17:83085179-83085201 CCCGGCCGGGTGCAGTGTTTTGG + Exonic
1161294619 19:3513374-3513396 CTGGGCCGAGTGCTGAGTCTAGG + Intronic
1161559971 19:4967771-4967793 CCAGGCCCGGTGCTGTGGCTCGG - Intergenic
1163434389 19:17286537-17286559 CCAGGCCCGGGGCTGAGTGCTGG + Exonic
1166684145 19:44785261-44785283 CCATGCCCGGTCCTAAGTTTTGG + Intronic
1167673986 19:50873436-50873458 CACGGCCAGGTGGTGAGTTTGGG - Exonic
927207023 2:20617272-20617294 CAGGGCCCGGGGCTGAGTGCTGG + Intronic
928420633 2:31135831-31135853 CCAGGCTCTGTGCTGGGTTTGGG - Intronic
930096456 2:47570335-47570357 CCGGCCCCGGGGCTGAGCTCCGG - Exonic
935060868 2:99606457-99606479 CCAGGCACTGTGCTGAGCTTTGG - Intronic
935606937 2:104980949-104980971 GCAGGCCTGGTGCTTAGTTTAGG - Intergenic
943762079 2:191621092-191621114 CCAGGCTCTGTGCTGAGTTTGGG + Intergenic
945198373 2:207258039-207258061 CCTGGCCAGGAGCTGAGTCTGGG + Intergenic
947633281 2:231666965-231666987 CCGTGCCTGGTGCTGAGTGGGGG - Intergenic
1174600992 20:51724685-51724707 CCAGGCCCTGTGCTGGGTTCTGG - Intronic
1175370135 20:58482821-58482843 CCGGACCCGGTTTTGAATTTGGG - Intronic
1175858697 20:62137514-62137536 CCTGGGACGGTGCTGGGTTTGGG - Intronic
1177207192 21:18023449-18023471 CAGGGACCAGTGCTGAGCTTGGG + Intronic
1181115665 22:20631420-20631442 CCGGGGCCTGGGCTGGGTTTAGG + Intergenic
950969838 3:17175213-17175235 CCTCTCCCAGTGCTGAGTTTTGG - Intronic
968550827 4:1222700-1222722 CAGGGCCCCGTGCTGAGTGGGGG - Intronic
969495459 4:7523744-7523766 CCGGGCTCAGTGCTGGGTGTTGG - Intronic
976183534 4:82421927-82421949 CCGGGCGTGGTGCTGTGCTTAGG - Intergenic
977388970 4:96383544-96383566 CCAGGCACTGTGCTGAGTGTTGG + Intergenic
992515930 5:77492262-77492284 CCGAGCCTGGGGCGGAGTTTGGG - Exonic
996347545 5:122503032-122503054 CCAGGCCAGGTTCTGAGTTTGGG - Intergenic
997446958 5:133947313-133947335 CCAGGCCCTGTGCTGAGTTTTGG - Intergenic
998512008 5:142721584-142721606 CCCAGCACAGTGCTGAGTTTGGG - Intergenic
999113302 5:149140916-149140938 CCGGGCCCTGTGCTAGGTATTGG + Intergenic
1001732075 5:173968186-173968208 CCAGTCCCAGTGCTGAGTTGAGG + Intergenic
1002968922 6:1994505-1994527 CCAGGCACTGTGCTGAGTTTGGG + Intronic
1003108851 6:3236674-3236696 CCGCGCCCGGCCCAGAGTTTTGG - Intronic
1007386262 6:41522291-41522313 CCGCGCCCAGCCCTGAGTTTTGG + Intergenic
1013117076 6:107111684-107111706 CCTGGCCTGGTGCTTAATTTTGG - Intronic
1017692306 6:156979391-156979413 CCTGCCCCAGTGATGAGTTTGGG + Intronic
1019634611 7:2068924-2068946 CCTGGCCTGGTGCTGAGCTCTGG - Intronic
1020212138 7:6165304-6165326 CCGGGCTCGGGGCTGAGATCCGG + Exonic
1026846992 7:73704009-73704031 CCGAGGCAGCTGCTGAGTTTGGG - Intronic
1029700939 7:102246524-102246546 CCGGGTCCTGTGCTGACTGTGGG - Intronic
1029853540 7:103489789-103489811 CCGTGCCCGCTGCAGAGCTTGGG + Exonic
1034443701 7:151101150-151101172 CCGGGCCTGGTGCTGGGCTGGGG - Intronic
1034911697 7:155003046-155003068 CCGGGCCCGGTCCTGCGAATCGG + Exonic
1037734281 8:21554523-21554545 CCAGGCCCTGTGCTAGGTTTTGG - Intergenic
1040443219 8:47466146-47466168 TCTGACCCAGTGCTGAGTTTAGG - Intronic
1040668774 8:49661268-49661290 TCTGACCCAGTGCTGAGTTTAGG - Intergenic
1049700209 8:144007555-144007577 CCGGGGCCTGTGCTGAGCTCTGG + Intronic
1055917503 9:81420795-81420817 CTGGGCCTGGTGATGATTTTTGG - Intergenic
1056532111 9:87497481-87497503 CCGGGCACGGTGCTTGGTATGGG - Intronic
1058878266 9:109262951-109262973 CCAGGCCCAGTGCTTAGCTTTGG - Intronic
1060300987 9:122374487-122374509 CCTGGCCCTGTGCTGAGTATGGG + Intronic
1061191025 9:129082788-129082810 CCAGGCCCTGTGCTGGGCTTGGG + Intronic
1061822836 9:133238320-133238342 CGGGGCCCGGGGCTGAATTTGGG - Intergenic
1062479242 9:136743839-136743861 CTGAGCCCGGGCCTGAGTTTGGG + Intergenic
1062588904 9:137264160-137264182 CAGGGCCTGGAGCTGTGTTTGGG + Intronic
1193715880 X:84934498-84934520 CCGGGCCCGGTGCCGAGGACTGG + Intergenic
1196633646 X:117973920-117973942 CCGGACCCGCTGTTGAGCTTTGG - Intronic