ID: 1141710333

View in Genome Browser
Species Human (GRCh38)
Location 16:85695284-85695306
Sequence CCCACGACCAGGCCTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141710324_1141710333 2 Left 1141710324 16:85695259-85695281 CCCCATCTGCAGTAGAACCACCG 0: 1
1: 0
2: 1
3: 4
4: 74
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240
1141710325_1141710333 1 Left 1141710325 16:85695260-85695282 CCCATCTGCAGTAGAACCACCGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240
1141710322_1141710333 7 Left 1141710322 16:85695254-85695276 CCCAGCCCCATCTGCAGTAGAAC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240
1141710327_1141710333 0 Left 1141710327 16:85695261-85695283 CCATCTGCAGTAGAACCACCGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240
1141710323_1141710333 6 Left 1141710323 16:85695255-85695277 CCAGCCCCATCTGCAGTAGAACC 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240
1141710321_1141710333 16 Left 1141710321 16:85695245-85695267 CCTCAAACTCCCAGCCCCATCTG 0: 1
1: 0
2: 2
3: 72
4: 910
Right 1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG 0: 1
1: 1
2: 0
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141710333 Original CRISPR CCCACGACCAGGCCTCCTCC TGG Intronic
900620821 1:3586868-3586890 CCCAAGCCCAGGCCTCACCCTGG + Intronic
900998959 1:6137934-6137956 CCCAGGTCCAGGCCCCCACCAGG - Intronic
901026843 1:6282847-6282869 CCCATGGCCTGCCCTCCTCCCGG - Intronic
901068296 1:6505050-6505072 CCCAGGAGCTGGCCTCCCCCAGG - Intronic
901833133 1:11906287-11906309 CCCATGAACGGCCCTCCTCCTGG - Intergenic
902981457 1:20126442-20126464 CTGACCACCAGGCCTCCTTCTGG - Intergenic
903175558 1:21578098-21578120 CCCAGGCCCAGCCCTCCTTCAGG + Exonic
903664889 1:25000180-25000202 TGCAAGACCAGGCCTCCTTCGGG - Intergenic
906175141 1:43764752-43764774 CCCACGGCCATGCCCCTTCCTGG - Intronic
913529196 1:119721435-119721457 CCCTAGACCAGGCATCCTCCTGG - Intronic
918202256 1:182278576-182278598 CCCAGCTCCAGGCCTCTTCCTGG - Intergenic
921188080 1:212686677-212686699 CCTGTGGCCAGGCCTCCTCCTGG - Exonic
924676559 1:246184435-246184457 ACAATGACCAGGCCTCCTCTGGG + Intronic
1067472678 10:46548056-46548078 CCCACGACCTGGCCTGTTTCTGG - Intergenic
1067508212 10:46874252-46874274 CCCAGGGCCAGGCCTCCATCAGG + Intergenic
1067654039 10:48177593-48177615 CCCAGGGCCAGGCCTCCATCAGG - Intronic
1069842698 10:71349666-71349688 CCCACACCCCGCCCTCCTCCAGG + Intronic
1070593485 10:77816859-77816881 CACACCACCAGGCCTACTGCTGG + Intronic
1070930744 10:80258958-80258980 CCCACCACAAAGCCTCATCCAGG + Intergenic
1070931768 10:80266010-80266032 CCCTGGCCCTGGCCTCCTCCAGG - Intergenic
1070949362 10:80418630-80418652 CCCACTCCCAGGCCTATTCCCGG + Intronic
1071509925 10:86255017-86255039 CCCAAGACCAGGCCTGCCCTTGG + Intronic
1073288968 10:102403993-102404015 ACCATGACCATGCCTCCCCCTGG - Intronic
1074683378 10:115933843-115933865 CCCACCATCAGCCCTCCTCTGGG + Intronic
1076097581 10:127744546-127744568 CCCAGGGCCAGGCCTACTGCTGG + Intergenic
1076307035 10:129472692-129472714 CCCAGCGCCAGGCCTCCTTCTGG - Intronic
1076643553 10:131935505-131935527 CCCAGGGACAGTCCTCCTCCAGG - Intronic
1076647112 10:131961172-131961194 CCCAGGCCCAGGCCTCTCCCAGG - Intergenic
1076691393 10:132225422-132225444 CCCGAGACCAGGCTGCCTCCAGG + Intronic
1077309019 11:1880352-1880374 CCCACTCCCACGCCTGCTCCTGG - Intronic
1077326461 11:1966043-1966065 GCCGCCACCAGGCCTGCTCCGGG - Intronic
1077579080 11:3405227-3405249 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1078097520 11:8309830-8309852 CCCAAGCCCAGGCATCCTACTGG + Intergenic
1080178480 11:29394830-29394852 CCCAGGAGCAGGCCACCTCTGGG - Intergenic
1080436223 11:32247407-32247429 CCCACAGCCAGGGCTCATCCTGG - Intergenic
1083918268 11:65764513-65764535 CTGGCGACCAGGCCTCATCCAGG - Intergenic
1084148959 11:67279234-67279256 CCAAGGGCCTGGCCTCCTCCAGG - Exonic
1084236102 11:67788746-67788768 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1084322536 11:68381592-68381614 CCCTCGCCCGAGCCTCCTCCAGG - Intronic
1084330318 11:68426174-68426196 CCCACGTACAGAACTCCTCCAGG - Exonic
1084836299 11:71804244-71804266 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
1087179612 11:95128758-95128780 CCCATGGCCCAGCCTCCTCCAGG - Exonic
1089200571 11:116722483-116722505 CCTCCATCCAGGCCTCCTCCAGG + Intergenic
1090206031 11:124884958-124884980 CCCAGTGCCAGGCTTCCTCCTGG + Intronic
1090872468 11:130760614-130760636 CCCAGCTCCATGCCTCCTCCTGG - Intergenic
1202809442 11_KI270721v1_random:21222-21244 GCCGCCACCAGGCCTGCTCCGGG - Intergenic
1092407010 12:8228110-8228132 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1094489061 12:30947254-30947276 ACCACTTCCAGCCCTCCTCCTGG - Intronic
1096186688 12:49586229-49586251 CCCACACCCAGGCCTCCACTGGG - Intronic
1096504900 12:52086613-52086635 CCCACGCCCACGGCTCCTCTGGG + Intergenic
1107992212 13:45828668-45828690 CCCAGGACCAAGCCTCTTTCAGG + Intronic
1108363202 13:49686336-49686358 CCCACCACCAAACCTCCTGCAGG + Intronic
1109845460 13:67983922-67983944 CCCACTTCCAGGCCTCCTGTTGG - Intergenic
1119919676 14:78434851-78434873 CTCACCACCTGGCCTCCTCTTGG - Intronic
1120190438 14:81435806-81435828 CCCACGTCCAGGCCGCCTCTGGG + Intronic
1121146364 14:91586315-91586337 CCCACAACCAGGGCTGCTCTTGG + Intronic
1122087334 14:99316932-99316954 GCCAAGGCCAGGCCTGCTCCAGG + Intergenic
1122704194 14:103609799-103609821 CTCCCACCCAGGCCTCCTCCTGG + Intronic
1122819067 14:104332205-104332227 CCCAAGGAGAGGCCTCCTCCGGG - Intergenic
1122850210 14:104523993-104524015 CCATGGATCAGGCCTCCTCCAGG + Intronic
1123938220 15:25204178-25204200 CCCAATACAAGTCCTCCTCCAGG - Intergenic
1125793797 15:42389599-42389621 CCCATGGCCAGGCCTCCTTCAGG + Intronic
1125888960 15:43251644-43251666 CCCACACCCAGGCCTGCTCTCGG - Intronic
1127829436 15:62737534-62737556 CCCACGTCCAGGACTCTGCCTGG - Intronic
1128470207 15:67945505-67945527 GCCACCACCAGCTCTCCTCCAGG + Intergenic
1128766263 15:70252973-70252995 CAGAGGACCAGTCCTCCTCCTGG - Intergenic
1129385982 15:75196276-75196298 CCATACACCAGGCCTCCTCCTGG - Intronic
1130866855 15:87940576-87940598 CCCTCAGCCAGCCCTCCTCCTGG + Intronic
1132010133 15:98268035-98268057 CCCATCACCAGCCCCCCTCCTGG - Intergenic
1132677141 16:1125502-1125524 CCCACTCCCAGTCCTGCTCCCGG - Intergenic
1132809871 16:1792386-1792408 GCCAGGGCCAGGCCTCCTGCGGG + Exonic
1132930043 16:2454423-2454445 GCCAGGGCCAGGCCCCCTCCTGG - Intronic
1133136646 16:3717173-3717195 CCCAAGACCCAGCCTCCTTCAGG + Intronic
1133347682 16:5081307-5081329 CCCAGGCCCAGCCCTCCTGCAGG - Intronic
1134029304 16:10978975-10978997 CCCAAGAACAGGCCTCCTGGAGG + Intronic
1135135959 16:19885392-19885414 CACACCGCTAGGCCTCCTCCAGG + Intronic
1136318213 16:29466365-29466387 CCCACCAACAGGCCTCGCCCGGG - Intronic
1136432788 16:30205714-30205736 CCCACCAACAGGCCTCGCCCGGG - Intronic
1136867616 16:33769684-33769706 CCCACCCCCAGGCCCCATCCTGG - Intergenic
1137617137 16:49855116-49855138 CCCCTGCCCAGGCCTTCTCCCGG - Intronic
1137901171 16:52271194-52271216 CCCAAGGCCAGTCCTTCTCCTGG + Intergenic
1138338317 16:56270014-56270036 CCCAAGTCCAGGCCTCCTGCAGG + Intronic
1139852671 16:69960407-69960429 CGCACGAGCACTCCTCCTCCCGG - Exonic
1139881642 16:70183315-70183337 CGCACGAGCACTCCTCCTCCCGG - Exonic
1140370866 16:74412190-74412212 CGCACGAGCACTCCTCCTCCCGG + Exonic
1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG + Intronic
1142290446 16:89191767-89191789 CCAAGGCCCAGGCCTCCTCCTGG + Exonic
1142304995 16:89279948-89279970 CTCCTGACCAGGCCTCCACCCGG - Exonic
1203104546 16_KI270728v1_random:1346519-1346541 CCCACCCCCAGGCCCCATCCTGG + Intergenic
1203128968 16_KI270728v1_random:1615849-1615871 CCCACCCCCAGGCCCCATCCTGG - Intergenic
1142809033 17:2386769-2386791 CCCACCCCCAGGCCTCCTAGGGG - Exonic
1143105737 17:4529911-4529933 CCCGCGTCCAGCCCTCCCCCGGG - Intronic
1143362446 17:6382927-6382949 CCCACCACCAGGCCTCCGTGTGG + Intergenic
1144558181 17:16300067-16300089 CCCACTTCCAGTCCTTCTCCAGG + Intronic
1147123971 17:38352809-38352831 CCCCCGCCCCCGCCTCCTCCCGG + Exonic
1147194063 17:38753355-38753377 CCCACACCCAGGCCTCTTCTTGG + Intronic
1147994883 17:44354978-44355000 CCCGGGACTTGGCCTCCTCCCGG - Exonic
1148339863 17:46866975-46866997 CTCACCCCCAGGCCTCCTACAGG + Intronic
1148777172 17:50102246-50102268 CACAGGGCCAGGGCTCCTCCAGG - Intronic
1148878621 17:50707853-50707875 CGCAGGCCCAGGCCTCCTCCCGG + Exonic
1149567335 17:57649632-57649654 CCCAGGGCCAGGCCTCTTCTTGG - Intronic
1149569551 17:57662877-57662899 TACACGACCACGCCTCCTCCCGG - Intronic
1151636445 17:75352131-75352153 CCCAGGTCCTGGCCTCCTTCAGG + Intronic
1151819943 17:76491951-76491973 CCTGGGACCAGGCTTCCTCCTGG + Intronic
1152214465 17:79024426-79024448 CCGCCGGCCAAGCCTCCTCCCGG - Exonic
1152347145 17:79760159-79760181 GCCAGGACAAGGCCTGCTCCTGG - Intergenic
1152381208 17:79943152-79943174 CCCACGCCCCAGCCTGCTCCTGG + Intronic
1152763503 17:82122254-82122276 CCCACCACCAGGCCAGCTGCTGG + Intronic
1153772343 18:8426030-8426052 CCCCCGAGGAGGCCTCTTCCTGG - Intergenic
1155127881 18:22898041-22898063 CCCAAGGCCAGGATTCCTCCAGG - Intronic
1156389166 18:36634625-36634647 CACACGGCCAGCCTTCCTCCAGG - Intronic
1157525475 18:48377090-48377112 CCCCACACCAGGCCTCCTGCAGG + Intronic
1157604517 18:48917496-48917518 CCCAAGACCAGGCCTCCTCCTGG + Intergenic
1160284714 18:77530913-77530935 TCCCAGGCCAGGCCTCCTCCAGG + Intergenic
1160902017 19:1433473-1433495 CCCACACCCCGGCCTCCACCAGG - Intronic
1160972757 19:1776696-1776718 CCCAGGAGCCCGCCTCCTCCGGG + Exonic
1161545485 19:4877954-4877976 CCCCGGGCCAGGCCTCCACCTGG + Intergenic
1163630049 19:18413644-18413666 CCCACGACCTCCCCTGCTCCTGG - Intergenic
1163781310 19:19250332-19250354 CCTACGTCCAGGCTTCTTCCTGG - Exonic
1164715398 19:30387201-30387223 CCCACATCCAGGCCTCCCTCTGG - Intronic
1164834872 19:31350185-31350207 CCCACGGGCAGGCCCCCTCCAGG + Intergenic
1165074894 19:33275319-33275341 CCCACCACCTGGATTCCTCCCGG + Intergenic
1165601932 19:37061016-37061038 CTCACGCACAGGCCCCCTCCTGG + Intronic
1165921667 19:39302446-39302468 CCCACGACCAAGTCTTCACCTGG + Intergenic
1166106440 19:40600297-40600319 CCCAGGACGAGGCCCCCTCTAGG + Intronic
1166505235 19:43367251-43367273 CCCAGGAGCAGGGCTCTTCCTGG - Intergenic
1166509322 19:43393844-43393866 CCCAGGAGCAGGGCTCTTCCTGG + Intergenic
1167281646 19:48572725-48572747 CCCTCGACTCAGCCTCCTCCAGG - Intronic
1167522103 19:49961120-49961142 CCCTCCACCAGGCTTCCTGCTGG - Exonic
1167523279 19:49969605-49969627 CCCTCCACCAGGCTTCCTGCTGG + Intergenic
1168309039 19:55451622-55451644 GCCCCGTCCACGCCTCCTCCCGG + Intergenic
925018936 2:553589-553611 CCCACCACCCGACCTCCTCCTGG - Intergenic
925143337 2:1564792-1564814 CCCACGGTCAGGCCACATCCTGG + Intergenic
925229832 2:2223894-2223916 TCCACCACCAAGCCTCCTCCAGG + Intronic
925317789 2:2938769-2938791 CCCACGGCCAGGGCTCCTACAGG + Intergenic
925730855 2:6918358-6918380 CCCAGGACCAGGAAGCCTCCAGG - Intronic
931685417 2:64788172-64788194 CCCACGCCCCTCCCTCCTCCAGG + Intergenic
932479011 2:72027600-72027622 CACACCACACGGCCTCCTCCTGG - Intergenic
936286375 2:111184501-111184523 CCCAGCCCCAGCCCTCCTCCAGG + Intergenic
937084463 2:119161516-119161538 CTCAAGACCAGCCCTCCACCAGG + Intergenic
939143253 2:138379836-138379858 CCCAAGACCAGGCCAACCCCAGG + Intergenic
947462888 2:230318464-230318486 CCCACACTCAGGCCTGCTCCTGG - Intergenic
947770629 2:232667459-232667481 CCCAGTTCCAGTCCTCCTCCAGG + Intronic
948048512 2:234961858-234961880 CCCACCACCCCACCTCCTCCAGG - Intronic
948076984 2:235172535-235172557 TCCACGCCTAGGCCCCCTCCAGG - Intergenic
948601980 2:239112488-239112510 CCCACCAGCAGGCCTGCTCTAGG - Intronic
948942099 2:241201729-241201751 CTCAGGAACAGGCCTCCTGCCGG - Intronic
948989607 2:241546890-241546912 CCCACCATGTGGCCTCCTCCTGG - Intergenic
949040115 2:241844143-241844165 CACGCGCCCCGGCCTCCTCCCGG + Intergenic
1170129318 20:13001609-13001631 CCAACGTCCAGGCCTCTTTCTGG + Intergenic
1170525131 20:17228723-17228745 GCCACCGCCAGGGCTCCTCCAGG + Intronic
1170547452 20:17446494-17446516 CCCATGACCAGGCCTCTTTGTGG - Intronic
1171959783 20:31485475-31485497 CCCAGGGCCCAGCCTCCTCCTGG + Intergenic
1175442727 20:59002606-59002628 TCCTCCACCTGGCCTCCTCCCGG + Intronic
1176172726 20:63703450-63703472 CCCAAGGCCAGGCGCCCTCCAGG + Intronic
1176297339 21:5081110-5081132 CCCAGGGCCACGGCTCCTCCAGG + Intergenic
1176692636 21:9934485-9934507 CCCACCAACAACCCTCCTCCTGG + Intergenic
1178293708 21:31391041-31391063 CCCACGTCCAGGCCTTCTAGGGG + Intronic
1179010586 21:37553043-37553065 CCCAGGCCCAGGCCGCCTCGAGG - Intergenic
1179029886 21:37711379-37711401 TCCACGAGCAGGCCTCTTCCAGG - Intronic
1179810316 21:43865537-43865559 CCCGGGCCCAGACCTCCTCCCGG - Intronic
1179859690 21:44180838-44180860 CCCAGGGCCACGGCTCCTCCAGG - Intergenic
1180059315 21:45376441-45376463 GCCACCTCCAGGCCACCTCCAGG - Intergenic
1180967874 22:19799958-19799980 TCCCCTCCCAGGCCTCCTCCTGG + Intronic
1181463298 22:23097738-23097760 CCCACGGCCATGCCTCATCAAGG - Intronic
1181804090 22:25364788-25364810 CCCTCGCCCGAGCCTCCTCCAGG + Intronic
1182572148 22:31247587-31247609 CCCACTACCAGGCTTCATTCTGG - Intronic
1182695802 22:32198699-32198721 CCCAGGGCCCGGGCTCCTCCAGG - Intronic
1184099337 22:42333856-42333878 CCCACCACGATGGCTCCTCCAGG + Intronic
1184231498 22:43160575-43160597 CCCATGATCAGGCCTCCCCCTGG + Intronic
1184241009 22:43211252-43211274 CCCACGCCAAGGGCTCTTCCTGG - Intronic
1184678021 22:46053984-46054006 CCCGCAACGAGGCCTGCTCCTGG - Exonic
1185244950 22:49768643-49768665 CTCACGTGCAGGCCCCCTCCAGG + Intergenic
1185337210 22:50276039-50276061 CCCAGGACGAGGCCTCCCCGGGG + Intronic
1185348491 22:50321113-50321135 CCCACCCCCAGTCTTCCTCCGGG - Intronic
1185365035 22:50433462-50433484 CGCACCCCCAGCCCTCCTCCAGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949661475 3:6283953-6283975 CCCTTGACCAGGTCTCCTTCTGG - Intergenic
950524281 3:13514429-13514451 CCCTAGACCAGGCTTCTTCCAGG + Intergenic
950579784 3:13854654-13854676 CCCACTTCCAGCCCTCGTCCCGG + Exonic
950661443 3:14469266-14469288 CCCAGGACCTTGCCACCTCCAGG - Intronic
950687235 3:14627358-14627380 CCCCCGCCCAGGCCTCCCACAGG + Intergenic
951528638 3:23678336-23678358 CCCATGACCAGCCCCCGTCCAGG + Intergenic
952205966 3:31181750-31181772 CCCAGTAGCCGGCCTCCTCCTGG + Intergenic
953850866 3:46464670-46464692 CCCGCGTCCGGGCCGCCTCCCGG + Intronic
953923566 3:46968670-46968692 TCCACCACTAGGCCTCCACCTGG + Intronic
954683729 3:52359479-52359501 CCCAACCCCAGGCCTCTTCCAGG - Intronic
954849604 3:53589422-53589444 CCCATGCCCAGGCTTCCTCTTGG - Intronic
954894402 3:53963598-53963620 CCCACGGGCAGGCCCCCTCGAGG + Intergenic
954987822 3:54811101-54811123 ACCAAGCTCAGGCCTCCTCCCGG + Intronic
958456314 3:94336199-94336221 CCCAAGACCAGACCTCCCCCTGG + Intergenic
961512242 3:127410111-127410133 CCCATGACCAGGCATAGTCCAGG - Intergenic
967726089 3:192863712-192863734 CTTACGACCTGGCCTCTTCCTGG - Intronic
967890106 3:194358957-194358979 CCTGCGCCCAGGCCCCCTCCGGG - Exonic
968427919 4:535425-535447 ACCGCGGCCCGGCCTCCTCCCGG + Intronic
968994870 4:3938920-3938942 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
969288362 4:6222314-6222336 CCCCCGGCCTGGCCGCCTCCCGG + Intergenic
969467163 4:7364515-7364537 CCCAGAAACAGGCCTCCTTCAGG - Intronic
969514749 4:7640787-7640809 CCCAGAGCCAGGCCTCCTACTGG - Intronic
969759133 4:9169874-9169896 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
969819096 4:9707354-9707376 CCCAGGCCCAGCCCTCCTGCAGG + Intergenic
981846569 4:149176385-149176407 CCCACAACCAGCCCTTCCCCAGG - Intergenic
983445810 4:167850475-167850497 CCCACTTCCAGGCTTCTTCCTGG + Intergenic
985086237 4:186315768-186315790 CCCCAGACCAGGCCCCCTTCTGG - Intergenic
985829176 5:2215379-2215401 CCGGCTACCAGGTCTCCTCCTGG + Intergenic
985939897 5:3127020-3127042 CCCAAGGCAAGGTCTCCTCCAGG - Intergenic
987100766 5:14589484-14589506 CCCACGCCCAGTCCCCCTCATGG - Intronic
988298221 5:29392215-29392237 CCCAAGAGCAGTCTTCCTCCTGG + Intergenic
988586478 5:32511792-32511814 ACCAGCACCAGGCCTCCTCAGGG + Intergenic
994497758 5:100535403-100535425 GCCACGACCGGGCCTCTCCCTGG + Exonic
997641906 5:135454979-135455001 CCCCAGACCAGGCCTGCACCTGG + Intergenic
1002098988 5:176848108-176848130 CCCACGCTGCGGCCTCCTCCAGG + Intronic
1003571189 6:7257795-7257817 TCCACACCCAGGCCTCCACCAGG + Intergenic
1004005222 6:11632013-11632035 CCCAAGACCAGGGCTCCCCAGGG + Intergenic
1006945702 6:37783323-37783345 GCCATCCCCAGGCCTCCTCCCGG - Intergenic
1007302229 6:40876038-40876060 CCCACCCCCAGCCCTCCCCCAGG - Intergenic
1007396193 6:41579051-41579073 CCCAGGACCAGGCTTTGTCCTGG + Intronic
1007680307 6:43629098-43629120 CCCACGGCCGGGCCCCCTCCGGG + Exonic
1011558532 6:88592538-88592560 CCCATGACCTGGCTTACTCCTGG - Intergenic
1012341506 6:98130896-98130918 CCCAAGACCAGGCCATCTTCTGG - Intergenic
1013224951 6:108114074-108114096 ACCACCACCACGCCACCTCCTGG - Intronic
1014736470 6:125100304-125100326 CCCATCCCCAGGGCTCCTCCTGG - Intergenic
1018735059 6:166681653-166681675 CACAGGACCAGGCCTCTCCCTGG + Intronic
1019306381 7:337261-337283 CCCTCCTCCAGGCATCCTCCTGG + Intergenic
1019725006 7:2597066-2597088 CGCACGACCCTGCCGCCTCCTGG - Intronic
1020319132 7:6927243-6927265 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1021633014 7:22665218-22665240 CCCACCTCCCCGCCTCCTCCGGG + Intergenic
1023876787 7:44290523-44290545 CCCTAGCCCAGGCCTCCTCATGG - Intronic
1024598946 7:50962955-50962977 ACCACCACCAGGCTTCCTGCAGG - Intergenic
1028477499 7:91266839-91266861 CCCATGCCCAGGCCTCGGCCGGG + Exonic
1029266338 7:99344188-99344210 CCCAAGACCACGTCTCATCCTGG + Intronic
1029708163 7:102286334-102286356 GCGACATCCAGGCCTCCTCCAGG + Intronic
1029734454 7:102457774-102457796 CCCACAGCCAGGCGTCGTCCAGG + Exonic
1031096787 7:117429560-117429582 TCCAAGACCAGGCTTCCTCAAGG - Intergenic
1034474536 7:151275011-151275033 CCCACCACATGGCCCCCTCCCGG - Intronic
1035076133 7:156178877-156178899 CCCAGGCCCAGTCCTCCTCAGGG + Intergenic
1035643603 8:1201476-1201498 CCCAGGACCTGGCTTCCTTCTGG - Intergenic
1036125432 8:6057664-6057686 GCCACAACCTGACCTCCTCCTGG + Intergenic
1036381280 8:8237905-8237927 CCCAGGCCCAGGCCTCCTGCAGG + Intergenic
1036847382 8:12179087-12179109 CCCAGGCCCAGCCCTCCTGCAGG - Intergenic
1037492343 8:19408261-19408283 CCTACTACCAGGCCCCCTCTTGG + Intronic
1040760227 8:50832909-50832931 CCCACCAGCAGCCCTCCCCCAGG + Intergenic
1041942793 8:63407402-63407424 CCCATGACCAGACCAGCTCCGGG + Intergenic
1045272634 8:100674949-100674971 GCCAGGACCACCCCTCCTCCAGG + Intergenic
1045345165 8:101287546-101287568 CCCAAGGTCAGGCCTCCTGCAGG - Intergenic
1045878914 8:107014980-107015002 CCCAAGACCAGGCCAGTTCCTGG + Intergenic
1049276222 8:141721372-141721394 CCCACGGCCAGGCCTGCTTTGGG + Intergenic
1049367897 8:142249478-142249500 CCCAGGACCTGCCCTCCTCGGGG - Intronic
1050594313 9:7190754-7190776 CCTACGACCATGACTCCTACTGG + Intergenic
1056110282 9:83388386-83388408 CCCACTTCCAGGCTACCTCCAGG + Intronic
1056663133 9:88559234-88559256 GCCATGAGCAGGCCTCCTCCCGG - Intronic
1057336373 9:94158782-94158804 CCCACATCCAGGCATCCTCAAGG - Intergenic
1060526630 9:124324633-124324655 CCCACCCCCAGGCCACCTCCAGG - Intronic
1061013547 9:127969098-127969120 CCCAAGGTCAGGCCTTCTCCTGG + Intronic
1061091483 9:128428908-128428930 CCCACCCCCCTGCCTCCTCCAGG + Exonic
1062070602 9:134553237-134553259 ATCCCCACCAGGCCTCCTCCTGG + Intergenic
1062186772 9:135222423-135222445 CACAGGGCCAGGCCTCCTGCAGG + Intergenic
1062199975 9:135297459-135297481 CCCACCTCCAGGCCTCCTCGAGG + Intergenic
1062262086 9:135667797-135667819 CCCATGCCCAGGCCTCCTCTGGG - Intergenic
1197711955 X:129678083-129678105 CCCACCCTCATGCCTCCTCCCGG + Intergenic
1198387966 X:136147158-136147180 CCCCCGGCCCGCCCTCCTCCCGG + Intergenic
1202603102 Y:26614598-26614620 CGTACGACCAGGCCTTCTACTGG - Intergenic