ID: 1141710637

View in Genome Browser
Species Human (GRCh38)
Location 16:85696933-85696955
Sequence CCGGCTCCTGGGTTTGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141710626_1141710637 12 Left 1141710626 16:85696898-85696920 CCTTGGGGGACCGGCATGTTCCT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153
1141710625_1141710637 15 Left 1141710625 16:85696895-85696917 CCTCCTTGGGGGACCGGCATGTT 0: 1
1: 0
2: 1
3: 5
4: 36
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153
1141710622_1141710637 21 Left 1141710622 16:85696889-85696911 CCCACGCCTCCTTGGGGGACCGG No data
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153
1141710624_1141710637 20 Left 1141710624 16:85696890-85696912 CCACGCCTCCTTGGGGGACCGGC 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153
1141710627_1141710637 2 Left 1141710627 16:85696908-85696930 CCGGCATGTTCCTGCCTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153
1141710629_1141710637 -8 Left 1141710629 16:85696918-85696940 CCTGCCTGCAGCGCGCCGGCTCC 0: 1
1: 0
2: 1
3: 23
4: 282
Right 1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG 0: 1
1: 0
2: 2
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141710637 Original CRISPR CCGGCTCCTGGGTTTGGCCG GGG Intronic
900114130 1:1021272-1021294 GCTGCTCCTGGGTGTGGCTGGGG + Intronic
900124642 1:1064013-1064035 CCGGCTCCTGGGTGGGGCGAGGG + Intergenic
900531431 1:3155318-3155340 CAGGCTGCAGGGCTTGGCCGCGG + Intronic
902807881 1:18872231-18872253 CAGGTGCCTGTGTTTGGCCGAGG - Exonic
902923909 1:19683189-19683211 CTGGCACCTGGGCTTGGCTGGGG + Exonic
904035074 1:27554583-27554605 CCGGCTCCTGGGATCAGCCATGG - Intronic
912952260 1:114128091-114128113 CCGGCTGCATGGTTTGGCCTGGG + Intronic
915980842 1:160419121-160419143 CCGTCACCTGGGTGTGGCAGCGG + Exonic
923512755 1:234666625-234666647 CCTGCCCTTGGGCTTGGCCGAGG + Intergenic
1063158863 10:3404598-3404620 ACGGCTGCTGGGATTGGCTGGGG + Intergenic
1067833803 10:49625566-49625588 GCGTGTCCTGGGTATGGCCGGGG - Exonic
1069534165 10:69240936-69240958 CCGGCCCCTGGGCTTGGCACTGG + Intronic
1069706646 10:70462871-70462893 GGGGCTCCTGGGTGTGGCCACGG - Intergenic
1070320287 10:75349778-75349800 CCTGGTTCTGGGTTTGGCCCTGG - Intergenic
1070707157 10:78648024-78648046 CTGGGTGCTGGGTGTGGCCGAGG - Intergenic
1074814591 10:117134697-117134719 CCGGCTGCTGGGTGGGGCTGCGG - Intronic
1076195833 10:128517163-128517185 TCTGCTCCTGGGTTGTGCCGTGG + Intergenic
1076507874 10:130989953-130989975 CCGGCTCGTGGGCTGGGCCAGGG - Intergenic
1076674374 10:132140597-132140619 CCGGGTCCTGGGCTTGGAGGAGG + Intronic
1076674386 10:132140636-132140658 CCGGGTCCTGGGCTTGGAGGAGG + Intronic
1076866468 10:133168773-133168795 ACAGCTCCTGGGTATGGGCGTGG + Intronic
1077483241 11:2826392-2826414 GCGGCTGCTGGGCCTGGCCGCGG - Intronic
1079450520 11:20597107-20597129 ACGGCTGCGGGGTTTGGCTGAGG - Intergenic
1083776537 11:64896850-64896872 CAGGCTCCTGGGTGTGGACAAGG - Exonic
1084385298 11:68839830-68839852 GCGGCTGCTGCGTTTGGCCCCGG - Intronic
1091458185 12:623658-623680 CAGGCTGCTAGGTTTGGCTGAGG + Intronic
1092095676 12:5839980-5840002 TGGGCTGCTGGGTTTGGCCAGGG - Intronic
1096674199 12:53217713-53217735 GCAGCTCCTGGGTTAGGCAGGGG + Intronic
1096789528 12:54036176-54036198 CAGGCTCCTGGGATGGGCTGGGG + Intronic
1101641269 12:106587037-106587059 CCGGCGTCTGGATTTGGCAGCGG + Intronic
1102310700 12:111842424-111842446 CAGGCTCCTGGGGTAGGGCGAGG - Intronic
1102951588 12:117034967-117034989 CCGGCTCCTGGCATTGTCTGTGG - Intergenic
1104040657 12:125128234-125128256 CCGGAACCTGGGCATGGCCGTGG + Exonic
1104522035 12:129485196-129485218 CTGTCTCCTGGGTTTCCCCGTGG - Intronic
1105031441 12:132887256-132887278 ACGGCTCCTGCGTCTGGGCGCGG - Exonic
1110630043 13:77697653-77697675 GCGGCTCCGGGTTTTAGCCGCGG - Intergenic
1113962845 13:114134685-114134707 CCGGCTCCTGTGTTTCTCCGAGG + Intergenic
1119426056 14:74535391-74535413 CAGGCTCCTGGGGCTGGCAGAGG - Intronic
1122714264 14:103684550-103684572 CCAGCACCTGGGGTTGGCAGTGG - Intronic
1122807270 14:104266201-104266223 CTGGCTTCTGGGTGTGGCTGGGG + Intergenic
1124801498 15:32837368-32837390 GCGGCTCCTGGGGGTGGCGGTGG + Intronic
1127382879 15:58444851-58444873 CCGGGTCCTGGGCTTGGCACTGG + Intronic
1132810152 16:1793460-1793482 GCGGCTGCTGGGGTTGGCAGGGG - Intronic
1132850693 16:2023700-2023722 GGGGCTCCGGGGTGTGGCCGTGG - Intergenic
1132975662 16:2709997-2710019 CCTGCTCCGGGCTTTGGCTGGGG - Intergenic
1133284010 16:4682306-4682328 CTGGCTCCTGGGGTTGGCCACGG + Intronic
1136412547 16:30085767-30085789 TGGGCTCCTGTGTTTGGCCCTGG - Intergenic
1136707783 16:32202934-32202956 ACGGCCCCTGGGTTGGGGCGGGG - Intergenic
1136760126 16:32726477-32726499 ACGGCCCCTGGGTTGGGGCGGGG + Intergenic
1136807978 16:33143909-33143931 ACGGCCCCTGGGTTGGGGCGGGG - Intergenic
1138473571 16:57257508-57257530 CCCTCCCCTGGGCTTGGCCGTGG + Intronic
1139511368 16:67430306-67430328 CTGGCTCTTGGGGTTGGCGGGGG + Intergenic
1141300815 16:82814004-82814026 CCGGCTGCTGTGCTTGGCTGTGG + Intronic
1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG + Intronic
1203062282 16_KI270728v1_random:986799-986821 ACGGCCCCTGGGTTGGGGCGGGG + Intergenic
1143493048 17:7294817-7294839 CCGGCCAATGGGTTGGGCCGGGG - Intergenic
1144960030 17:19039659-19039681 GGGGCTCCTGGGGTTGGCAGGGG + Intronic
1144975130 17:19134865-19134887 GGGGCTCCTGGGGTTGGCAGGGG - Intronic
1148108004 17:45129750-45129772 CCCGCTCCTGGGCTGGGCTGCGG - Intronic
1148156862 17:45429707-45429729 CGGGCTCCTGGGTGTGCCCGCGG - Intronic
1148905893 17:50911905-50911927 CCAGCTCCTGGGGATGACCGGGG - Intergenic
1149665888 17:58364566-58364588 GCTGCTCCTGGGCTTGGCCTGGG + Intronic
1150060458 17:62064979-62065001 CCGCCTCCCGGGGCTGGCCGCGG + Intronic
1150190915 17:63238056-63238078 CCTGCTACTGAATTTGGCCGTGG - Exonic
1151557219 17:74852605-74852627 CCGGCTCCTGGGGGCGGGCGGGG + Exonic
1151821466 17:76499319-76499341 CCAGCTCCTGGGCATGGACGTGG + Intronic
1152786411 17:82250240-82250262 GTGGCACCTGGGTTTGGCCCCGG - Intronic
1152816267 17:82409976-82409998 CAGGCTCCTGAGCTTGGCCCAGG - Intronic
1154133102 18:11752568-11752590 GCTGCTCCTGGGTAAGGCCGAGG + Intronic
1160835625 19:1123235-1123257 CCGGGTCGGGGGTGTGGCCGCGG + Intronic
1161346352 19:3770574-3770596 CCGGTTCTCGGGTTGGGCCGAGG + Exonic
1161916320 19:7231052-7231074 CTGGCTCCTGGCTCTGGCCAAGG - Intronic
1162572174 19:11480124-11480146 CCGCCTCCCGGGTGCGGCCGAGG + Intronic
1163023230 19:14495070-14495092 CCGGCTCCTGGGTGTTTCCGGGG + Intronic
1163405475 19:17119388-17119410 CCGGCTTCTGGTGTTGGCTGAGG + Intronic
1165074001 19:33270642-33270664 CCACCACCTGGGTTTGGCCCAGG - Intergenic
1165863216 19:38919949-38919971 CCGGCTGCTGGGTGGGGCTGGGG + Intronic
1166315028 19:41984888-41984910 CAGGCTCCTGGGTCTGGGTGGGG - Intronic
1166733737 19:45072425-45072447 CCCGCTCCTGGGCCTGGCCGAGG - Exonic
1166784206 19:45357997-45358019 CTGGCTCCTGGCTTTGGCGTGGG - Intronic
1167277134 19:48545414-48545436 CAGGCTCCTGGGTTTGATGGAGG - Intergenic
1167622682 19:50568104-50568126 CCGGCTCCTGGGTGGGGAGGGGG + Intergenic
1167696745 19:51019545-51019567 CCGGCTCCTGCCTGTGGCCCGGG + Intronic
926141827 2:10372567-10372589 CCGGCTGCTGGGTTCTGCCTTGG - Intronic
927216593 2:20670967-20670989 CCGGTTCCTGGGTCGGGCAGCGG - Exonic
933952399 2:87342264-87342286 GCGCCTCCTGTGTGTGGCCGGGG + Intergenic
934538840 2:95158768-95158790 CAGTCTCCTGGGTCTGGCAGGGG - Intronic
936491098 2:112972796-112972818 TTGGCTTCTGGGTTTGGCCAAGG + Intergenic
937251086 2:120524278-120524300 CCTGCTCCCGGGTCTGGCTGTGG + Intergenic
939973926 2:148694767-148694789 CCGTCACCAGGGTTTGGGCGGGG - Intronic
940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG + Intronic
941415632 2:165217535-165217557 CTGGCTCCTGGGATTAGCCAAGG - Intergenic
942360735 2:175168638-175168660 CCGGCTCCTGGGGCTGGGCTCGG - Intergenic
946865694 2:224039389-224039411 CCGCCTCCTTTGTGTGGCCGCGG + Intergenic
948397873 2:237661079-237661101 CCGCTTCCTGGGTTGGGCTGCGG + Intronic
948401213 2:237686905-237686927 CCGGCTCCTGGCATTGACCTGGG + Intronic
948560719 2:238849321-238849343 GCGGCTCCAGGGTTTGCCTGGGG + Intronic
1170655940 20:18288152-18288174 TCGGCTTCTGGGGTTGGCGGAGG - Intergenic
1172154124 20:32811558-32811580 CCAGCTACTGGGTGTGGCTGAGG + Intergenic
1173865157 20:46308350-46308372 CCGGCTCCTGCGGGCGGCCGCGG - Exonic
1173873501 20:46356112-46356134 CCCGCTCCTGGGCTCTGCCGAGG - Intronic
1174842978 20:53917192-53917214 CCGGGACCTGGGATTGGCCTTGG - Intergenic
1175989408 20:62780223-62780245 CGGGCTCCTGGGCTTGGGCAGGG - Intergenic
1180183830 21:46129845-46129867 CAGGCTCCAGGGTTTGGGTGTGG + Intronic
1181316311 22:21972950-21972972 TTGGCTCCTGTGGTTGGCCGGGG - Intronic
1181542320 22:23580091-23580113 GCTGCTGCTGGGTCTGGCCGTGG - Exonic
1181746278 22:24956941-24956963 CCTGCTCCTGGCTGTGGCCTTGG + Intronic
1181919813 22:26311871-26311893 CCTGCTCCAGGGAGTGGCCGGGG - Exonic
1182848016 22:33447416-33447438 CCGGCTCCTGGTTTGGCCCTCGG - Intronic
1183862221 22:40678600-40678622 CTGGCTCCTGAGTCTGGCAGTGG + Intergenic
1185395181 22:50583065-50583087 CCGGCGCCTCGGATTGGCCCAGG - Intronic
950163337 3:10775978-10776000 ACCGCTCCTGGGGTTGGCTGCGG + Intergenic
953351818 3:42221675-42221697 CCGGCTCCAGGATTTTGCTGGGG - Intronic
955687258 3:61560779-61560801 CCCGCACCCCGGTTTGGCCGCGG - Intergenic
961489777 3:127246790-127246812 CTTCCTCCTGGGTTTGGCTGTGG - Intergenic
961647603 3:128400829-128400851 CCGGGTCCTGGCTTGGGCTGGGG - Intronic
966927638 3:184655829-184655851 CCATCTCTTGGGTTTGGCAGGGG - Intronic
968405373 4:336373-336395 GCGGCTCCTGGGGTCTGCCGGGG + Intergenic
968490152 4:885706-885728 CTGACTCCTGGGCTTGTCCGTGG + Intronic
968574582 4:1359657-1359679 CAGCCACATGGGTTTGGCCGTGG + Intronic
968636583 4:1684141-1684163 CCGGCTCCGAGCTTTGCCCGCGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
972102941 4:35445524-35445546 GGGGCACCTGGGTTTGGCCCAGG - Intergenic
973698334 4:53512973-53512995 CCAGCTCCAGGGTTTGGCCGTGG - Intronic
974064489 4:57065159-57065181 CCGCCTCCTGGCGTGGGCCGAGG - Intronic
976765498 4:88593208-88593230 CCGCCTCCTGGGCGGGGCCGGGG + Intronic
981348280 4:143700049-143700071 CCGGCACCTGCGGGTGGCCGTGG + Exonic
985552588 5:541143-541165 CCGCCTCCTGGGTTGGGTCCTGG + Intergenic
985971921 5:3384886-3384908 ACGGCTGCTGGGGTTGGCGGGGG + Intergenic
987383271 5:17306262-17306284 CCGCCTCCCGGGTTTGCCAGTGG - Intergenic
995574373 5:113513929-113513951 CCGGCTCCTGGCGGTGGCGGAGG + Exonic
996092323 5:119363245-119363267 CAGGCTCCTGGTTTTAGCTGAGG - Intronic
1002594094 5:180311119-180311141 CCTGCTCTGGGGTTTGGCCCTGG + Intronic
1007108303 6:39298239-39298261 GCTGCTCCTGGGTCTGGCCTTGG + Intergenic
1007367801 6:41407016-41407038 CGGGCCCCTTGGTTGGGCCGCGG - Intergenic
1013349254 6:109290756-109290778 ACGGGGCCTGGGTCTGGCCGGGG - Intergenic
1014517619 6:122399483-122399505 TCGGCTCCTGGGATTGGCCAGGG + Intergenic
1018686374 6:166307621-166307643 TAGGCGCCTGGGTTCGGCCGAGG + Exonic
1018704684 6:166455286-166455308 CCGGCTCCTGGGCTTCGGAGCGG - Intronic
1019606335 7:1912045-1912067 CAGACTTCTGGGTTTGGCCATGG - Intronic
1026639154 7:72109295-72109317 AGGCCTCCAGGGTTTGGCCGTGG - Intronic
1029495755 7:100894997-100895019 CCGGCTCCTGGCTCGGGGCGGGG - Intronic
1030422292 7:109322953-109322975 ACGGCTGCTGGGATTGGCCAAGG - Intergenic
1035757695 8:2046441-2046463 CTGGCGCCTGGGTTCGGCCGTGG + Intronic
1037817339 8:22119135-22119157 CCCGCTCCTGCCTCTGGCCGAGG + Intronic
1038808042 8:30812590-30812612 CCGCCTGCTGGGCTTGGGCGGGG - Exonic
1039394589 8:37214540-37214562 GAGGCTCCTGGGGTTGGCAGAGG + Intergenic
1043836130 8:85049015-85049037 CCGGATCCTGGGTTTGCTAGGGG - Intergenic
1047679787 8:127242866-127242888 CAGGCTACTGGGTGAGGCCGTGG + Intergenic
1049347435 8:142146355-142146377 CCGGCTGCTGGGTTTCTCTGTGG - Intergenic
1049686910 8:143942727-143942749 CCGGCCCGTGGGTTGGGGCGCGG - Intronic
1053152999 9:35754662-35754684 GCAGCTCCTGGGTTTGGCTGGGG - Exonic
1056975026 9:91245215-91245237 GGGGCTCCTGGGGTGGGCCGTGG - Intronic
1060855989 9:126915169-126915191 CCGGCGCCGGGGCCTGGCCGGGG + Intronic
1061392830 9:130327304-130327326 ATGGATCCTGGGTTTGGCTGCGG - Intronic
1061862974 9:133477323-133477345 CCAGCTCCTGGGGTCGGCCTAGG - Intronic
1062035472 9:134380756-134380778 CCGGCACCTGGGTCTGGCCGAGG + Intronic
1062248964 9:135584595-135584617 CCTGCTCCATGGTTTGGCCTGGG + Intergenic
1062255310 9:135618057-135618079 CCGGCTCCAGGATGTGGCTGGGG - Intergenic
1062396970 9:136356493-136356515 CCGGCTCCTGGGGCTCGCCGTGG - Exonic
1062517609 9:136944240-136944262 CCGGGTCCTTGGTTGGGCGGCGG - Intronic
1185877747 X:3713727-3713749 CCGGCTCCTGGGCTGGGTCGGGG - Intergenic
1185894294 X:3843985-3844007 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185899413 X:3882409-3882431 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1185904530 X:3920838-3920860 CTGGCTCCTGGGCTGGGTCGCGG - Intergenic
1188137966 X:26512899-26512921 TGGGCTTCTGGGTTTGGGCGAGG - Intergenic