ID: 1141711535

View in Genome Browser
Species Human (GRCh38)
Location 16:85702274-85702296
Sequence GCTGCTAAGCAGGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141711529_1141711535 7 Left 1141711529 16:85702244-85702266 CCTCTTAGGGAGTGTGGAGAGTT 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG No data
1141711527_1141711535 14 Left 1141711527 16:85702237-85702259 CCTTTGGCCTCTTAGGGAGTGTG 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141711535 Original CRISPR GCTGCTAAGCAGGCAGTGGA GGG Intronic
No off target data available for this crispr