ID: 1141712418

View in Genome Browser
Species Human (GRCh38)
Location 16:85707810-85707832
Sequence GGGCCTGGGAAACACTGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141712406_1141712418 26 Left 1141712406 16:85707761-85707783 CCGGAGTCAGCAAGAACCTGGAG 0: 1
1: 0
2: 1
3: 16
4: 209
Right 1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 286
1141712414_1141712418 -8 Left 1141712414 16:85707795-85707817 CCGGTCCACTCAGCGGGGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 286
1141712410_1141712418 10 Left 1141712410 16:85707777-85707799 CCTGGAGGTGTCAGAGGTCCGGT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG 0: 1
1: 0
2: 2
3: 29
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141712418 Original CRISPR GGGCCTGGGAAACACTGTTC TGG Exonic
904387452 1:30152921-30152943 GGGCCAGGGAAACAATGATGTGG + Intergenic
904612436 1:31732859-31732881 GGGCCTGGGGCACCCTGGTCGGG + Intronic
908037878 1:60075132-60075154 GGGCCTTGGGAAGACTGATCTGG - Intergenic
909039712 1:70634587-70634609 GAGCCTGAAAAACACTGGTCTGG - Intergenic
910853331 1:91670094-91670116 GGGCCTGCAACACACTGCTCTGG + Intergenic
911161411 1:94686032-94686054 GGTGCTGGGAACCACTCTTCTGG + Intergenic
912873097 1:113327943-113327965 AGGCCTGGGACTCACTCTTCAGG + Intergenic
913250560 1:116909693-116909715 TGGCCTGGGAAAGACTCGTCTGG - Intergenic
913573816 1:120148978-120149000 TAGCCTGGGAAATACTATTCTGG - Intergenic
914295079 1:146313780-146313802 TAGCCTGGGAAATACTATTCTGG - Intergenic
914556120 1:148764563-148764585 TAGCCTGGGAAATACTATTCTGG - Intergenic
914616714 1:149365668-149365690 TAGCCTGGGAAATACTATTCTGG + Intergenic
915532184 1:156509046-156509068 GGGGGTGGAGAACACTGTTCTGG + Intergenic
916470208 1:165116480-165116502 GGGCATGTGAAACACAGTTTGGG - Intergenic
916766295 1:167863744-167863766 GGGCCTGCCACACACTGCTCTGG - Intronic
917709270 1:177668151-177668173 GGGAGAGGGAAACACTGATCAGG - Intergenic
918006359 1:180545261-180545283 GGTCCTGGGAACCTCTGATCTGG + Intergenic
920594902 1:207259366-207259388 AGGCCTGGGACTCACTTTTCAGG + Intergenic
921074367 1:211687673-211687695 GGGCCTGCCACACACTGCTCTGG - Intergenic
921188651 1:212691076-212691098 GAGGCTGAGAAACCCTGTTCTGG + Intronic
921278380 1:213541823-213541845 GGGCCTGGGCAAAACTTTACTGG + Intergenic
921296130 1:213705494-213705516 GGGCCTGGGACTCACCCTTCAGG + Intergenic
921444347 1:215227362-215227384 GGGACTGGGAAACAGCATTCTGG + Intronic
923776827 1:236986379-236986401 GTGCCTGGGAAACACCATTTAGG - Intergenic
1062854395 10:772463-772485 GGGCCAGGGAAGCCCTGCTCTGG - Intergenic
1063415450 10:5869435-5869457 GGGCCTGAGAAGCACTGCCCAGG + Intronic
1063926058 10:10979005-10979027 AAGCCTGGGGAACACTTTTCAGG - Intergenic
1064446621 10:15399316-15399338 AGGCCTGGGACTCACTCTTCAGG - Intergenic
1065930774 10:30476731-30476753 GGGCCTGCCACACACTGCTCTGG - Intergenic
1066050842 10:31633399-31633421 GGGGCTGGGGAACCCTGCTCTGG - Intergenic
1068422122 10:56807997-56808019 TGGCCTGGGACATACTCTTCAGG + Intergenic
1068672054 10:59733400-59733422 GGGCCTGCCACACACTGCTCTGG + Intronic
1069353528 10:67557877-67557899 GGGCCTGAGAAACTCTGTCAGGG + Intronic
1069380475 10:67839250-67839272 GGCCCTAAGAAACACAGTTCAGG + Intergenic
1069692530 10:70363352-70363374 GGGCCAGGGAGAGACTTTTCTGG - Intronic
1070610119 10:77926966-77926988 GAGCCTGGGAAACACGGCCCAGG - Intergenic
1070815563 10:79320726-79320748 GGGCCTGGGAAAAACAAGTCTGG + Intergenic
1071715898 10:88095041-88095063 TGTCCTGGGAAAGAATGTTCAGG - Intergenic
1074038178 10:109761809-109761831 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1074116001 10:110457947-110457969 CCGCCTGGGAACCACTGGTCGGG + Intergenic
1074601237 10:114915895-114915917 TGGCCTGGGTAATTCTGTTCAGG + Intergenic
1076264200 10:129096747-129096769 GGGCTTGGGAAACCCTCTTCTGG + Intergenic
1076562986 10:131379560-131379582 GGGCCTGGTGAACACAGTTCTGG - Intergenic
1077979792 11:7288143-7288165 GGGCCTGGGAAACCCTGGGAGGG + Intronic
1080708216 11:34719571-34719593 GAGCCTGGGAAAGACTGACCAGG + Intergenic
1082300779 11:50502671-50502693 GGGGTTTGGAAACACTGTTGTGG - Intergenic
1083366676 11:62145545-62145567 GGGCCTGTCACACACAGTTCTGG + Intronic
1083959752 11:66007953-66007975 GGCCCTGGGAAAGTCTGCTCAGG + Intergenic
1083966313 11:66045965-66045987 GCTCCTCGGAAACACTGATCAGG + Intronic
1084476676 11:69393436-69393458 AGGCCTGGGAAGCACTGGCCTGG + Intergenic
1085030796 11:73269820-73269842 AGGCCTGGGAAAGCTTGTTCCGG - Intronic
1085391041 11:76182361-76182383 GGGCCTGGGAAGCGCAGTCCAGG - Intergenic
1085998568 11:81951862-81951884 GGGCCTGCCACACACTGCTCTGG - Intergenic
1086946830 11:92852082-92852104 GGGTCCAGGAAACACTTTTCTGG - Intronic
1087350116 11:97020494-97020516 AGGCCTGGGACTCACTCTTCTGG - Intergenic
1087836028 11:102875999-102876021 TGGCCTGGGAAACAGTCTGCTGG + Intergenic
1087950790 11:104218605-104218627 GGGCCTGGGACACATTCTTCAGG + Intergenic
1088361985 11:109001085-109001107 TGGCCTGGGACTCACTGTTCAGG + Intergenic
1088895447 11:114074820-114074842 GGGCCGGGGAGACCCTGTGCAGG + Intronic
1089320730 11:117625074-117625096 AGGTCTGGGAATCACTGGTCTGG + Intronic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1092461734 12:8693257-8693279 GGACCTGGGTAACTCTGTTAGGG + Intronic
1092620964 12:10267972-10267994 GGGCCTTGTAAACCATGTTCAGG + Intergenic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1096207427 12:49734623-49734645 GGGCCTGCCACACACTGCTCTGG - Intronic
1096353975 12:50924600-50924622 GGGCCTTGGCAGCACTCTTCTGG + Intronic
1096530812 12:52241722-52241744 GGGCCTGGGTCCCACTGTTCTGG + Intronic
1096718165 12:53503262-53503284 AGCCCTGGAAAACCCTGTTCAGG - Intronic
1097276459 12:57816824-57816846 GGGCCTGGGACAAAGGGTTCTGG + Intronic
1098503962 12:71227287-71227309 AGGCCTGGGACTCACTCTTCAGG - Intronic
1102169022 12:110827913-110827935 GTGCAGGGGAAAGACTGTTCTGG + Intergenic
1102878623 12:116467066-116467088 AGCCCTGGGAAAAACTGTCCTGG - Intergenic
1103737198 12:123068116-123068138 GGGCCTAGAAAAAGCTGTTCAGG - Intronic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1107038363 13:35923461-35923483 GGGCCTAGGGAACATTGTTAAGG + Intronic
1108403889 13:50081216-50081238 GGGCTTGGGAAACTCTTTCCTGG + Intergenic
1108583222 13:51845256-51845278 GGGCCTGGGGAACACTGCAGGGG - Intergenic
1109218585 13:59617377-59617399 GGGCCTGAGAAACAGTCTTGTGG + Intergenic
1110653980 13:77975419-77975441 GGGCCTGCCACACACTGCTCTGG + Intergenic
1111496501 13:89057294-89057316 AAACCTGGGAAACACTATTCTGG - Intergenic
1111712839 13:91838932-91838954 GAGCATGGGAAACATGGTTCAGG - Intronic
1111870131 13:93821480-93821502 GGGCCTGGGATGCACAGTTCAGG + Intronic
1112498814 13:99926534-99926556 GGGCCTGGGCATCACTGTGGGGG + Intergenic
1116481098 14:45392271-45392293 AGGCCTGGGATTCACTCTTCAGG - Intergenic
1118436127 14:65772282-65772304 TGGTCTGAGAAACACAGTTCCGG + Intergenic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119544306 14:75460550-75460572 GTGCCTGGGAACCACTGGCCTGG + Intronic
1121020018 14:90574061-90574083 TGGCCTGGGAATGACTGTCCAGG + Intronic
1121103470 14:91265142-91265164 GAGGCTGGGAAACTCTGTCCCGG - Intergenic
1122694856 14:103547561-103547583 GGGCCTGGGGAAGAGTGTGCAGG - Intergenic
1124377257 15:29136078-29136100 GGGCCTGGGGAACCCAGTGCTGG - Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1124987632 15:34637264-34637286 GAGCATGGGAAACATGGTTCAGG - Intergenic
1125198146 15:37072254-37072276 ATGCCTGGGAAACCCTGTTCTGG - Intronic
1127196442 15:56591142-56591164 TGGCCTGGGACTCACTCTTCAGG - Intergenic
1127625954 15:60780346-60780368 AGGCCTGGGAACCACTGGGCTGG + Intronic
1128213184 15:65916481-65916503 GGGCCTTGGAACCACAGGTCAGG + Intronic
1128741590 15:70087683-70087705 AGGCCAGGGAAACCCTGTTGGGG - Intronic
1129521007 15:76186291-76186313 GCCCCTGGGAAACACTGTGGAGG + Intronic
1129607231 15:77030877-77030899 GGGCCTGGGGAACAGGGCTCAGG + Intronic
1130907432 15:88250556-88250578 GGGCCTTGGGAACTCTGATCCGG + Intronic
1132203146 15:99968909-99968931 TGGACTGGGAAATACTGTTAGGG - Intergenic
1133334920 16:5000785-5000807 GGGCCTGGGAAGGACTGTGTGGG + Intronic
1136097989 16:27972720-27972742 GGGCCTGGGATTCACATTTCCGG - Intronic
1137041873 16:35620707-35620729 GGGCCTGCCACACACTGCTCTGG + Intergenic
1138438870 16:57022476-57022498 GGGGCTGGGAGACACAGTTAGGG - Intronic
1138844912 16:60554049-60554071 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1138916584 16:61471825-61471847 TGGCCTGGGACTCACTTTTCAGG - Intergenic
1139103790 16:63801828-63801850 TGGCCTGGGACTCACTTTTCAGG + Intergenic
1140513949 16:75529103-75529125 GGGCCTGGCGACCACAGTTCGGG + Exonic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1143180734 17:4982511-4982533 GGGCCTGGGCATCAGTGTTCTGG + Intronic
1144706324 17:17370800-17370822 GGCCCTGGGAAGCACATTTCTGG - Intergenic
1145837824 17:27968108-27968130 GAGTTTGGGAAACACTGTTTTGG + Intergenic
1146265354 17:31449239-31449261 GGGGCTGGGATCCAGTGTTCAGG - Intronic
1147035056 17:37673700-37673722 GTGACCTGGAAACACTGTTCTGG + Intergenic
1147670949 17:42176481-42176503 GGGCCTGGGAAATACTTGGCAGG - Intronic
1147920744 17:43915456-43915478 GGCACTGGGAAGCACTGTTGGGG - Intergenic
1148097037 17:45059705-45059727 GGGCCTGGGGCACACAGATCTGG + Intronic
1149945141 17:60917313-60917335 GGGCCTGGGAAACAGAGTACTGG - Intronic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1152129399 17:78466934-78466956 GGGCCTGGGCAGCACAGTCCTGG + Intronic
1152453401 17:80397953-80397975 GGGCCTGCTACACACTGCTCTGG - Exonic
1153193900 18:2571899-2571921 GGGCCTGGGGGACACTGATGAGG + Intronic
1153356571 18:4143487-4143509 AGGCCTGGGACTCACTCTTCAGG + Intronic
1153662726 18:7339833-7339855 GGGTCTGGGAAACAGTGGGCTGG + Intergenic
1154014343 18:10603537-10603559 GGGCCTGCTACACACTGCTCTGG + Intergenic
1156782184 18:40863812-40863834 GGGGCTGAGAAGCAATGTTCAGG - Intergenic
1157718926 18:49908518-49908540 GGGCCTGGGAGACCCAGATCTGG - Intronic
1161124431 19:2547796-2547818 GGGCCTGGGAGCCTCTGTCCTGG - Intronic
1161830277 19:6597679-6597701 GGGCCTGCCACACACTGCTCTGG - Intronic
1162281638 19:9702739-9702761 GGGCCTGCCACACACTGCTCTGG - Intergenic
1162506013 19:11085582-11085604 GGGCCTGGGGAACGCTGTTCTGG + Intergenic
1163062100 19:14768270-14768292 TGGCCTGGGACCCACTGTCCAGG - Intronic
1163367063 19:16881169-16881191 GGGGCTGGGAAAGGCTGTGCTGG + Intergenic
1163943795 19:20517909-20517931 GGGCCTGCCACACACTGCTCTGG + Intergenic
1164120771 19:22262826-22262848 GTGACTAGGAAACACTATTCAGG + Intergenic
1164455651 19:28404414-28404436 GGCCTTGGGAAACACTGTTGAGG + Intergenic
1166408297 19:42539517-42539539 AGGCCTGGGACTCACTCTTCAGG + Intronic
1166856140 19:45783413-45783435 GGGCCTGGGAAACGTGGTCCTGG + Exonic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167534273 19:50039596-50039618 AAGCCTGGGAAACCCTGCTCTGG + Intronic
926313598 2:11693312-11693334 AGGCTTGGGAAACACTGATCTGG + Intronic
927201887 2:20583169-20583191 GGGCCTGAGAAACTCAGCTCAGG - Intronic
928458911 2:31451119-31451141 TCGCCTGGGACTCACTGTTCAGG - Intergenic
928715508 2:34055768-34055790 AGGCCTGGGACTCACTCTTCAGG + Intergenic
933613393 2:84459691-84459713 GGGCCTGGGATACAAAGTTCTGG - Intronic
934792871 2:97077259-97077281 GGTCCTGGGTAAGTCTGTTCTGG + Intergenic
934813743 2:97306425-97306447 GGTCCTGGGTAAGTCTGTTCTGG - Intergenic
934823952 2:97402055-97402077 GGTCCTGGGTAAGTCTGTTCTGG + Intergenic
935225454 2:101048289-101048311 GGGCATGGCACACACTGTACTGG + Intronic
935970326 2:108524523-108524545 GGGCCTGCCACACACTGCTCTGG - Intergenic
936419854 2:112353353-112353375 GGGCCTGCCACACACTGCTCTGG + Intergenic
937552159 2:123107673-123107695 TGGCCTGGGACTCACTCTTCAGG + Intergenic
937736497 2:125297002-125297024 GGGCCTGGGACACACCCTTTAGG + Intergenic
938990550 2:136623960-136623982 GGGCTTTGGAAACATTTTTCTGG - Intergenic
939191741 2:138924597-138924619 GGGCCTGGGAAACACGGGCCTGG - Intergenic
939319633 2:140601584-140601606 GAGCCTGGGATACACTGTACTGG - Exonic
941896999 2:170639180-170639202 GGAGCTGGGAAACAATGTCCTGG - Intronic
941928734 2:170920671-170920693 TGACCTGGGAAGCACTTTTCAGG - Intergenic
942150831 2:173075208-173075230 GGGCATGGGCAACATTATTCAGG - Intergenic
942511893 2:176711100-176711122 GAGGCTTGGAAACACTGCTCTGG - Intergenic
943408605 2:187518722-187518744 GGAGCTGGAAAACACTCTTCGGG - Intronic
945463257 2:210136751-210136773 GGGCCTGCGAAACACTATAATGG + Intronic
946996486 2:225398166-225398188 GGGACTGAGAACCACTGTACTGG + Intergenic
948107029 2:235422480-235422502 AGGCTTGAGAAACACTGGTCTGG - Intergenic
1169486969 20:6042017-6042039 GGGCCTTGGAGACACTCTGCTGG + Exonic
1170940637 20:20845470-20845492 GGGCCTGGGACACACAGGGCAGG - Intergenic
1171938004 20:31294095-31294117 TGGCCTGGGAATCACCCTTCAGG - Intergenic
1172815332 20:37681714-37681736 GCCCCAGGGAAATACTGTTCAGG - Intergenic
1174061971 20:47839303-47839325 GGGTCTGGCAAACCCTGGTCTGG + Intergenic
1174081223 20:47971977-47971999 GGGTCTGGGAATCACTGTCCTGG - Intergenic
1174135277 20:48374911-48374933 GGGTCTGGGAATCACTGTCCTGG + Intergenic
1175514144 20:59558235-59558257 GGGCCTGCCACACACTGCTCTGG + Intergenic
1175905243 20:62376449-62376471 GGGCCTGGGGAGCCCTGTCCAGG - Intergenic
1176250296 20:64117368-64117390 GGGCCTGGGCAAAGCTGTGCGGG + Intergenic
1176250789 20:64118977-64118999 GGGCCTGGGCAAAGCTGTGCGGG + Intergenic
1178485883 21:33020031-33020053 GGGCCGGGGAGACACCGCTCGGG + Intergenic
1178776816 21:35559351-35559373 AAGCCTGGGAAACACTGTTCTGG - Intronic
1179671159 21:42949647-42949669 GGGCCTGCCACACACTGCTCTGG + Intergenic
1179885182 21:44310846-44310868 GGGCCTGGGTAACAGGGTCCGGG - Intronic
1180154871 21:45972885-45972907 CGGCCCGGGAGACCCTGTTCCGG - Intergenic
1181052270 22:20243522-20243544 GGGCCTAGGAAACACTGCAATGG + Intronic
1182001918 22:26926737-26926759 GTGCCTGGGACACACCGTGCTGG - Intergenic
1182435742 22:30328582-30328604 GGGCCTGGGACAGACTATTCAGG + Intergenic
1183343544 22:37294870-37294892 GGGCCGGGGCCACCCTGTTCCGG - Intronic
1183603438 22:38853453-38853475 GGGCCTGGGAAACATCGGTGCGG - Intergenic
1183767828 22:39895460-39895482 TGACCTGGAAAACATTGTTCAGG + Intergenic
1183966912 22:41447513-41447535 GGGCCTGGGCCACGCTGTGCGGG + Intergenic
1184227682 22:43138853-43138875 TGACCTGTGAAACACTGTGCAGG - Intronic
1184512598 22:44942259-44942281 GTGCCTGGCACACACTGTCCCGG - Intronic
1185054260 22:48569827-48569849 GGGCCTGGGAAACAGTGAGAGGG - Intronic
1185129925 22:49033104-49033126 GGGCCTGGGAAAGACATTTCTGG + Intergenic
1185297840 22:50062914-50062936 GGCCCGGGGGAACATTGTTCAGG + Intronic
949403827 3:3693941-3693963 GGGACTGGGGACCCCTGTTCTGG - Intergenic
950268503 3:11593795-11593817 GGGCCTTTGAAACACGGTCCTGG - Intronic
950695608 3:14699123-14699145 AGGCCTGGGACTCACTTTTCAGG + Intronic
951248815 3:20370791-20370813 GGGCCTGCCACACACTGCTCTGG + Intergenic
951807703 3:26664606-26664628 GGTCCTGTGAAACACTGGTTGGG + Intronic
952498645 3:33938245-33938267 AAGCCTGAGAATCACTGTTCTGG - Intergenic
954108450 3:48421394-48421416 GAGCCAGGGACACACTGTTGGGG + Intronic
955020512 3:55116420-55116442 GATCCTGGGAAACACTGTATTGG - Intergenic
957965866 3:87321901-87321923 GGGCCTGGGACCCACCCTTCAGG - Intergenic
958000231 3:87740700-87740722 GGGCCTGCCACACACTGCTCTGG + Intergenic
959717055 3:109444444-109444466 AGGCCTGGGACTCACTCTTCAGG - Intergenic
959783309 3:110262996-110263018 GGGACTGGGAGAGAGTGTTCAGG + Intergenic
960142499 3:114164599-114164621 TGGTTTGGGAAACACTGGTCTGG + Intronic
960183309 3:114608470-114608492 ATGTTTGGGAAACACTGTTCTGG + Intronic
961167439 3:124773254-124773276 GGTTCTGTGAAACACTGTTTGGG + Intronic
963115054 3:141721025-141721047 TGACCTTGGAAACAATGTTCTGG + Intergenic
964735892 3:159916724-159916746 GGCACTGGGAAACACTGCTAGGG + Intergenic
965160642 3:165129175-165129197 TGGCCTGGGACTCACTCTTCAGG + Intergenic
968346956 3:198016566-198016588 GAGTTTGGGAACCACTGTTCCGG + Intronic
968464386 4:743194-743216 GGGCCTGGGAAACCCAGGTGCGG - Intronic
968480113 4:829478-829500 GGGTCTGGGAAGCACTGTCAGGG + Intergenic
969102422 4:4779067-4779089 GGGACTGGGCACCTCTGTTCAGG - Intergenic
969482069 4:7451977-7451999 GGGCCTGGGTCACACTGTGAAGG - Intronic
972339638 4:38140261-38140283 GACTCTGGGAAACACAGTTCTGG + Intergenic
973227469 4:47802384-47802406 AGGCCTGGGACTCACTCTTCAGG - Intronic
977072568 4:92409841-92409863 TGGCCTGGGACAGACTGTGCTGG + Intronic
977521863 4:98094613-98094635 TGGCCTGGGACACACCCTTCAGG - Intronic
980080905 4:128342945-128342967 GGGCCTGGGACACAGTTGTCAGG + Intergenic
982662949 4:158228558-158228580 GGGCCTGCCACACACTGCTCTGG + Intronic
983989098 4:174096842-174096864 GGGCCTGAGAAACAGTTTTTTGG - Intergenic
985702593 5:1382529-1382551 AGGCCTGGGAAAGCCTGTTGAGG + Intergenic
985813202 5:2105606-2105628 AGGTCTGGGAAACACAGGTCTGG + Intergenic
987102743 5:14606436-14606458 GAGCCTGGGAATCTCTGTTGTGG - Intronic
988001774 5:25358664-25358686 AGGCCTGCGACACACCGTTCAGG - Intergenic
989849432 5:46190460-46190482 GCAGCTTGGAAACACTGTTCTGG + Intergenic
994090666 5:95807068-95807090 GTGCCTGGGAAACGCTGCTAAGG + Intronic
995473230 5:112524516-112524538 GGGCCTGCCACACACTGCTCTGG - Intergenic
998249846 5:140545079-140545101 GGGCCTCAGAAACACACTTCAGG - Intronic
998872435 5:146565989-146566011 GGGCGGGGGAAACACTGTTAAGG + Intergenic
1001571204 5:172731873-172731895 GTTCCTGGGCAACACTGTTGCGG + Intergenic
1004800568 6:19142418-19142440 GTGCCTGGTAAACACGGTTTTGG - Intergenic
1005273849 6:24195546-24195568 GAGATTGGGAAACTCTGTTCTGG - Intronic
1005383772 6:25264901-25264923 GGGCTTGGGAAACACTAGCCAGG + Intergenic
1006519758 6:34564489-34564511 GGCCCTGGGCAAGACAGTTCTGG + Intergenic
1006570466 6:34999007-34999029 GGGCCTGCCACACACTGCTCTGG - Intronic
1007728438 6:43931206-43931228 GGGACTGGGAACCAGTGCTCTGG - Intergenic
1007965949 6:46003837-46003859 AAGGCTGGGAAACCCTGTTCTGG + Intronic
1009207392 6:60819058-60819080 GTTCCTTGGAAAGACTGTTCTGG - Intergenic
1010322758 6:74531947-74531969 TAACCTTGGAAACACTGTTCTGG + Intergenic
1010528915 6:76942310-76942332 TGGCCTGGGACACACCCTTCAGG - Intergenic
1012073736 6:94657384-94657406 AGGCCTGGGACTCACTCTTCAGG + Intergenic
1013312379 6:108908056-108908078 AAGTCTGGGAAACACTGTTGTGG - Intronic
1013417675 6:109939256-109939278 GTGCCTGGGAAACACCATTGAGG + Intergenic
1018482643 6:164207246-164207268 GAGCCTGAGAACCACTGCTCTGG - Intergenic
1019051939 6:169190280-169190302 GGGCCCGGGAGACACTGGGCAGG - Intergenic
1020044167 7:5028067-5028089 GGGCCTGCCACACACTGCTCTGG + Intronic
1020142939 7:5622413-5622435 GGGCCTGGGAAGCATTGCTCAGG - Intronic
1020502314 7:8938872-8938894 GGCCCTGAGAAACTCTGTTGAGG + Intergenic
1022360729 7:29654410-29654432 GGAGCTGGGAGACACTGCTCTGG - Intergenic
1022594993 7:31704880-31704902 GGGTTTGGGAAGCACTGGTCTGG - Intronic
1022700924 7:32759903-32759925 GGAGCTGGGAGACACTGCTCTGG + Intergenic
1022709621 7:32838528-32838550 GGACTTTGTAAACACTGTTCTGG - Intergenic
1022914261 7:34931593-34931615 GGACTTTGTAAACACTGTTCTGG + Exonic
1022936469 7:35184134-35184156 GGAGCTGGGAGACACTGCTCTGG + Intergenic
1023285257 7:38612525-38612547 GGGCCTCAGAAACACTGATATGG + Intronic
1025599664 7:62980064-62980086 GTGCTTTGGAAACACTGTTTTGG + Intergenic
1028373646 7:90121432-90121454 GGAGCTGGGAGACACTGCTCTGG - Intergenic
1029485831 7:100839634-100839656 GGGCCTGCCACACACTGCTCTGG - Intronic
1031454139 7:121958572-121958594 GGGTCTGGGAGGCACTGGTCTGG - Intronic
1032470174 7:132172489-132172511 AGGGCTGGGAAACACTGGTTTGG + Intronic
1032510109 7:132465686-132465708 GGGCCTGGGAATGTCAGTTCGGG + Intronic
1033336352 7:140455897-140455919 GGACCTGGGAAACAATGAACAGG + Exonic
1035339696 7:158152362-158152384 GGGCCTGGGAAGCTGTCTTCAGG + Intronic
1037636072 8:20701931-20701953 ATGCCTGGGAAACTCTCTTCGGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039640766 8:39218737-39218759 AGGCCTGGGACTCACTCTTCAGG + Intronic
1039901755 8:41757814-41757836 GGGCCTCGCCCACACTGTTCAGG + Intronic
1039966198 8:42285774-42285796 GAGCCTTGGAAACAGTGCTCAGG + Intronic
1040320675 8:46296823-46296845 GGAGGTGGGAAACACTTTTCTGG - Intergenic
1040993662 8:53379123-53379145 GGGCCTGCCACACACTGCTCTGG + Intergenic
1041084941 8:54247939-54247961 GGGACTGGGAAGGACTGTCCAGG - Intergenic
1041515128 8:58691490-58691512 GGGCCTGCCACACACTGCTCTGG - Intergenic
1042879942 8:73476198-73476220 GGGCCTGATAAATTCTGTTCTGG - Intronic
1043760551 8:84062834-84062856 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1043852799 8:85233841-85233863 GGCCATGGGAAACACTCTTTGGG + Intronic
1045967750 8:108044982-108045004 GAACCTAGGAAATACTGTTCTGG + Intronic
1045983637 8:108221652-108221674 GGGCTTGAGAAACACTGTCCAGG + Intronic
1046770385 8:118111761-118111783 GGGCCTGCGAAGCGCTGCTCGGG - Exonic
1047452466 8:124977787-124977809 TGGACTTGGAAAAACTGTTCAGG + Exonic
1050949191 9:11566690-11566712 AGGCCTGGGACTCACTCTTCAGG + Intergenic
1053162873 9:35825683-35825705 GGGCCTGAAAGACAGTGTTCTGG + Exonic
1053602708 9:39626773-39626795 GCGCATGGGGACCACTGTTCTGG + Intergenic
1054564935 9:66750175-66750197 GCGCATGGGGACCACTGTTCTGG - Intergenic
1054707523 9:68478181-68478203 GGGCCTGTGACACACTCTTCTGG + Intronic
1056883791 9:90420624-90420646 TGGCCTGGGCCACACTATTCAGG - Intergenic
1057645849 9:96874817-96874839 GGGCCTGGGAAACAAATTTTAGG + Intronic
1061513371 9:131074246-131074268 GAGCCTTGAAAACACTGTGCTGG - Intronic
1061915563 9:133751391-133751413 TGGCCTGGGACTCACTGTTCAGG + Intergenic
1062553727 9:137104147-137104169 GTCCCTGAAAAACACTGTTCAGG + Intronic
1203760301 EBV:9544-9566 GCTTCTGGGAAACACTGTTTCGG - Intergenic
1186146527 X:6630066-6630088 GGGCCTTGGAGAAACTGTACAGG + Intergenic
1186436091 X:9544226-9544248 GGGCCTGTGAAACTCTGGTGAGG + Intronic
1187078194 X:15957525-15957547 GCCCCTGGTAAACACTGATCTGG + Intergenic
1187272825 X:17794030-17794052 GGGCCTGGGAAGGTCTGTTCAGG + Intergenic
1187314847 X:18183659-18183681 AGGCCTGGGACTCACTCTTCAGG - Intronic
1188078490 X:25807657-25807679 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1188617095 X:32170657-32170679 GAGGTTGGGAAACACTGGTCTGG - Intronic
1188715651 X:33456619-33456641 TGGCCTGGGACACACCTTTCAGG - Intergenic
1189670247 X:43400616-43400638 TGGCGTGGGACTCACTGTTCAGG - Intergenic
1189770033 X:44416551-44416573 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1189854387 X:45209284-45209306 TGGCCTGGGACTCACTCTTCAGG + Intergenic
1192451399 X:71247330-71247352 CTGCCTGGGACTCACTGTTCAGG + Exonic
1192470226 X:71391998-71392020 GGGGTTGGTAAACACTATTCAGG + Intronic
1193488291 X:82115271-82115293 GGGCCTGAGACTCACCGTTCAGG + Intergenic
1194079968 X:89449334-89449356 GGGCTTGGGAAACTATGTACAGG + Intergenic
1194925252 X:99816454-99816476 TGGCCTGGGAATCACTCTTCAGG - Intergenic
1197343480 X:125303002-125303024 TGGCCTGGGAAACTCTGAGCTGG - Intergenic
1197582638 X:128303412-128303434 GAGCCTAGGAAATACTCTTCTGG + Intergenic
1197623515 X:128778908-128778930 AGGCCTGGGAATCACTCTTCAGG + Intergenic
1198064241 X:133080583-133080605 GGGCCTGTGAAAAACGGTTCTGG - Intronic
1198430785 X:136564593-136564615 TGGCCTGGGACTCACTCTTCTGG + Intergenic
1198941327 X:141959650-141959672 TGTCCTGGGATAGACTGTTCTGG + Intergenic
1199740955 X:150735921-150735943 GGGCTTTGGAGACCCTGTTCAGG - Intronic
1200432590 Y:3104608-3104630 GGGCTTGGGAAACTATGTGCAGG + Intergenic