ID: 1141712757

View in Genome Browser
Species Human (GRCh38)
Location 16:85709617-85709639
Sequence CAGAGGTATCACAGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141712757 Original CRISPR CAGAGGTATCACAGAGAGGC AGG Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
901048175 1:6411496-6411518 GAGAGCTATCACAGAGGGGAAGG + Intergenic
901211609 1:7529602-7529624 CAGAAGTATCACAGAGGAGCAGG - Intronic
902428405 1:16342948-16342970 CAGCTGTATCACAGTGTGGCAGG - Intronic
902683083 1:18057556-18057578 CAGAGGCATCTTAGCGAGGCTGG - Intergenic
902956334 1:19926350-19926372 AAAAGATATCACTGAGAGGCTGG - Intergenic
904344112 1:29856930-29856952 CAGAGCTCCCCCAGAGAGGCAGG - Intergenic
908071259 1:60462897-60462919 CAGAGGAGCCACAGAGGGGCAGG + Intergenic
908906609 1:69019911-69019933 CAGAGGTAACACAGAAAGATTGG - Intergenic
909075659 1:71047784-71047806 CAGAGGTTTCCCAGAGAGGAAGG - Exonic
909576381 1:77181251-77181273 CAGAGGAATTTCAGGGAGGCAGG - Intronic
909591498 1:77353971-77353993 CAGAGTTATCATGGAAAGGCAGG - Intronic
909934746 1:81538328-81538350 CAGAGCTATTACACAGAGGGAGG - Intronic
912976266 1:114333512-114333534 GAGAGGTATAACCAAGAGGCTGG + Intergenic
914639491 1:149590513-149590535 CAGAGTTCTCACAGAGAGATGGG + Intergenic
915850249 1:159314140-159314162 CAAAGGCATCACAGAATGGCAGG + Exonic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
918198213 1:182242519-182242541 GAGAGATCTCACAGAGAGGGTGG + Intergenic
919496195 1:198271625-198271647 CAGAGTTATCAAAGAGAGATGGG - Intronic
921297436 1:213717986-213718008 CATATGCATCACAGAGGGGCTGG - Intergenic
922554325 1:226521383-226521405 CAGTGATATCGCAGAGGGGCAGG - Intergenic
922616144 1:226962272-226962294 CACAGGGATGAGAGAGAGGCTGG - Intronic
922741128 1:228014785-228014807 CAGAGGTACGGCAGAGATGCTGG - Intronic
922867594 1:228873437-228873459 CAGTGGCATCCCAGCGAGGCAGG + Intergenic
922873092 1:228918837-228918859 CATGGGTAATACAGAGAGGCAGG - Intergenic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
924827205 1:247552141-247552163 AAGAGTTGTCACAGAGAGGAGGG + Intronic
1063050624 10:2443368-2443390 CAGAGGGGTCACAGTGTGGCAGG + Intergenic
1063691619 10:8292948-8292970 CAGAGCTTACACAGAAAGGCTGG + Intergenic
1065695256 10:28373711-28373733 CAGAGGCTTCAGGGAGAGGCAGG - Intergenic
1066661106 10:37738877-37738899 CAGAGAGACCACAGAGATGCAGG + Intergenic
1067460846 10:46457164-46457186 CAAAGGTTTCACAGAGGGACAGG + Intergenic
1067626345 10:47927436-47927458 CAAAGGTTTCACAGAGGGACAGG - Intergenic
1070155814 10:73834556-73834578 CAGAGGAAGGACAGAGAGGTAGG - Intronic
1070987713 10:80702614-80702636 CAGAGGTCTCACAGAGGCACAGG - Intergenic
1071490923 10:86135744-86135766 AAGCGGAATCACAGAGAGGCTGG + Intronic
1071906684 10:90182034-90182056 CAGAGGTCACACAGACAGGTGGG - Intergenic
1072782903 10:98262235-98262257 CAAAGATGGCACAGAGAGGCAGG + Intronic
1072933359 10:99687758-99687780 CAGAGGGATCACAGACAGTAGGG - Intronic
1073331518 10:102673022-102673044 CAGAAGTAGCACTCAGAGGCTGG + Intergenic
1074258361 10:111826787-111826809 CAGAGATTTCAAAGGGAGGCAGG - Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1076032125 10:127168454-127168476 CAGATGCATCACAGAAAAGCAGG - Intronic
1076612261 10:131733724-131733746 CAGAGGGTTCACAGTGAGGCAGG + Intergenic
1077022629 11:425346-425368 ACGATGTACCACAGAGAGGCTGG + Intronic
1077043309 11:534005-534027 GAGAGGTACCAGGGAGAGGCTGG - Intronic
1077238865 11:1500246-1500268 GAGAAGTGTCACAGAAAGGCAGG + Intronic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077297059 11:1831351-1831373 CAGGGGGCTCACAGAGAGCCAGG - Intronic
1077905448 11:6529308-6529330 CAGAGCCAAAACAGAGAGGCCGG - Intronic
1078447710 11:11416974-11416996 CAGAGGAGTCACATAGAGGAAGG - Intronic
1080393538 11:31870200-31870222 TAAAGATAGCACAGAGAGGCTGG + Intronic
1081198197 11:40186770-40186792 CAGAAATGTCAGAGAGAGGCAGG - Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1084196256 11:67524780-67524802 CAGAGGGGGCACAGAGGGGCAGG - Intergenic
1084321475 11:68375760-68375782 CAGAGGTGGCACAGAGACGGGGG - Intronic
1085859180 11:80212115-80212137 CAGAGGAGCCCCAGAGAGGCTGG - Intergenic
1087080797 11:94169260-94169282 CAGAGGAGACACAGAGAGGTGGG + Intronic
1088895117 11:114072653-114072675 TAGAGGTCTTACAGAGATGCTGG - Intronic
1088921993 11:114266450-114266472 CAAATGAATCACAGTGAGGCTGG - Intronic
1090105733 11:123852158-123852180 CAGAGGGATGACACAGAGGCTGG - Intergenic
1090772994 11:129938265-129938287 CAGAGGGAACAGAGAGAGTCTGG - Intronic
1090801241 11:130173795-130173817 CAGAGGGGTTACAGAGAAGCGGG - Intronic
1095709607 12:45274435-45274457 ACGAGGTGTCACAGAAAGGCAGG - Intronic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1098081511 12:66790910-66790932 AGAAGGTATCAAAGAGAGGCTGG + Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1098724753 12:73949205-73949227 CATAGGTATAAAAGGGAGGCAGG - Intergenic
1099461909 12:82932817-82932839 AACAGGTATCACAAAGAGGTGGG - Intronic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1100029111 12:90164238-90164260 CAGAAGAATAACACAGAGGCAGG - Intergenic
1101176930 12:102161809-102161831 CAGAGTTATCACAGGATGGCAGG + Intronic
1102194725 12:111016900-111016922 CAGAGGTAAAAGAGAGAGGGAGG - Intergenic
1102213863 12:111146466-111146488 CAGAAGTATCACAGACTGGGTGG - Intronic
1103973847 12:124689178-124689200 AAGAGGAATCACAGAGAGGTGGG + Intergenic
1104254934 12:127127801-127127823 CAGAGGGATAAGAGAGAGTCTGG - Intergenic
1104615820 12:130267678-130267700 CAGGGGCATCACAGAGTGCCTGG - Intergenic
1104824704 12:131700945-131700967 CAGAGGAGTCACAGAAATGCTGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106033844 13:26026331-26026353 CTGAGGCATCACAGAGAACCTGG - Intergenic
1107330677 13:39296423-39296445 CAGAGGTTACACAGAGCAGCAGG - Intergenic
1108688174 13:52838888-52838910 CTGAGGCTTCACAGAGGGGCAGG + Intergenic
1110070866 13:71175275-71175297 CAGGGTTCTCACAGACAGGCTGG + Intergenic
1110084783 13:71364388-71364410 CAGAGCCATCAGAGAGAGCCTGG - Intergenic
1110895106 13:80740411-80740433 CAGAGGAATTACAGAGAGAATGG + Intergenic
1112951912 13:105008684-105008706 CAGAGGCTTCACAGAGAAGGAGG - Intergenic
1113743730 13:112728326-112728348 TACAGGTAACACAGGGAGGCGGG - Intronic
1113743772 13:112728546-112728568 TACAGGTAACACAGGGAGGCGGG - Intronic
1113743789 13:112728619-112728641 TACAGGTAACACAGGGAGGCGGG - Intronic
1113755363 13:112807754-112807776 CAGATGTATCACAGATAGCACGG - Intronic
1116641277 14:47466543-47466565 CAGCTTTGTCACAGAGAGGCTGG - Intronic
1117161725 14:52996196-52996218 CAGTGATATCACAGTGAGACTGG - Intergenic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119742323 14:77022145-77022167 CTGAGGGATCAGAGAAAGGCTGG + Intergenic
1120747300 14:88164021-88164043 CAGAGGTCACACACAGAGGAAGG - Intergenic
1122379489 14:101291633-101291655 CAGGGGTCACACAGAGAGCCAGG + Intergenic
1122781140 14:104144039-104144061 CAGAGGCTGCACAGCGAGGCTGG - Intronic
1124203263 15:27696685-27696707 CAGAGGTGTTACAGAGAGAGAGG + Intergenic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1124498814 15:30208766-30208788 CAGAGGTCTGGCAGAGAGGGAGG - Intergenic
1124744765 15:32329910-32329932 CAGAGGTCTGGCAGAGAGGGAGG + Intergenic
1126007447 15:44271729-44271751 CAGAAGTGTCAGAAAGAGGCTGG + Intergenic
1126585273 15:50280012-50280034 AAGTGGAATCACAGAAAGGCAGG - Intronic
1127301148 15:57655103-57655125 CTGAGCTATCACAGAGAAGGGGG + Intronic
1127816771 15:62617550-62617572 CACAGGGAGCTCAGAGAGGCTGG - Intronic
1127886649 15:63207385-63207407 CAGAGGAGTCTGAGAGAGGCCGG - Intronic
1130072686 15:80661781-80661803 CAGAGGCTTCACAGAGAAGGAGG - Intergenic
1134848687 16:17462415-17462437 CAGAGGCATCACAAAGAAGATGG - Intronic
1135034103 16:19062065-19062087 TAGAGTTGTCACAGAGTGGCCGG - Exonic
1135287896 16:21209891-21209913 CAGAGGCTTCCCAGAGATGCTGG + Intronic
1135554448 16:23424451-23424473 AAGAGGCATCACAGTGAGGCAGG - Intronic
1135620267 16:23949852-23949874 CTGAGGTCTCACAGGTAGGCTGG + Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137417975 16:48303167-48303189 GACAGGTATACCAGAGAGGCAGG + Exonic
1138356248 16:56383347-56383369 CAGAGGTCTGGCAGAGAGGGAGG - Intronic
1138529681 16:57628289-57628311 CAAAGTTCCCACAGAGAGGCCGG - Intronic
1139782341 16:69362212-69362234 CAGAGGGGCTACAGAGAGGCAGG - Intronic
1140557934 16:75943029-75943051 CAGAGGTCTCTCAAAGAGGAAGG + Intergenic
1141108588 16:81253665-81253687 CAGAAATATCTCAGTGAGGCTGG + Intronic
1141712757 16:85709617-85709639 CAGAGGTATCACAGAGAGGCAGG + Intronic
1142275906 16:89118799-89118821 CAGAGTTATCAGGGAGGGGCTGG + Intronic
1142279858 16:89142175-89142197 CAGGGCTATCACTGAGAAGCAGG + Intronic
1143620016 17:8075403-8075425 CAGTGGCATCTCAGAGAGGTTGG - Intronic
1143711756 17:8740603-8740625 CAGAGGTAGGAGAGAGAGGGAGG + Intronic
1147690355 17:42311246-42311268 CATAGGGTTCACAGAGAGTCTGG - Exonic
1147857152 17:43490017-43490039 TAGAGGTATCACAGAAAATCTGG - Intronic
1148774921 17:50089882-50089904 GAGAGGCTTCACAGAGATGCAGG - Intronic
1149093483 17:52813681-52813703 CAGAGGTAACAAAGAGGAGCTGG - Intergenic
1150167092 17:62954565-62954587 AAGAGGTATCACTTAGAGTCCGG - Intergenic
1151150987 17:72086662-72086684 CGCAGGTATCTCAGAGAGGGAGG + Intergenic
1151287243 17:73121773-73121795 CCTAGGTACAACAGAGAGGCTGG - Intergenic
1151398793 17:73842414-73842436 CTGAGGTATTCAAGAGAGGCTGG + Intergenic
1151694515 17:75707341-75707363 CAGAGATAACACACAGAGGAAGG - Exonic
1151938773 17:77280403-77280425 CTGAGGTATCACAGCGAGTGTGG - Intergenic
1153781176 18:8496170-8496192 CTCAGGCATCACAGAGAGACTGG - Intergenic
1154209219 18:12365125-12365147 CAGAGCAATCCCAGAGGGGCTGG + Intronic
1155641809 18:28026490-28026512 CAGAGGTATCAAGGGTAGGCAGG + Intronic
1155930507 18:31702730-31702752 CAGTGGTATCTCAGGAAGGCAGG + Intergenic
1156005112 18:32430954-32430976 CAGGGATATCACAGAGAGAAAGG + Intronic
1156683353 18:39617195-39617217 CCAAGGTTTCACAGAGAAGCAGG + Intergenic
1158414958 18:57242133-57242155 CAGTGGTAACTCAGAGAGGCAGG + Intergenic
1159002693 18:62987880-62987902 CAGAAGTGTCAGAAAGAGGCAGG - Intergenic
1160515850 18:79478813-79478835 CAGCGGCATCAGAGAGAAGCTGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1163267391 19:16229189-16229211 CAGGGGCATCACAGAGAGGGAGG - Intronic
1163391366 19:17032719-17032741 CTGAGGGAGCACAGAGATGCTGG - Intergenic
1164794649 19:31015867-31015889 CACAGGAAGCACAGAGAGGGTGG + Intergenic
1166712048 19:44944067-44944089 CAGAGGTAGCTCAGACAGGGTGG + Intronic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
925138086 2:1533615-1533637 GGGAGGTTTCACAGAGTGGCGGG - Intronic
925138774 2:1536385-1536407 GGGAGGTTTCACAGAGTGGCGGG - Intronic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
931389807 2:61831945-61831967 CAGAGATATAAAAGACAGGCTGG + Intronic
932707691 2:74039313-74039335 CAAAGAAATCTCAGAGAGGCTGG - Intronic
935668901 2:105538633-105538655 CAGAGGTTTCCCAGAGAAGAGGG + Intergenic
942312977 2:174672704-174672726 CGGAGGCATCACAGACATGCTGG + Intronic
945285174 2:208074924-208074946 CACAGGAAGCACAGAGAGGCGGG - Intergenic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
1168975953 20:1966036-1966058 CAGAGTTTTCACAGAGATCCCGG - Intergenic
1172066970 20:32228213-32228235 CAGAGGACGCACAGAGAGCCTGG - Intronic
1174553149 20:51375789-51375811 CAGAGGTGCCCCGGAGAGGCTGG + Intergenic
1175673392 20:60926270-60926292 GAGAGGAAACACTGAGAGGCCGG - Intergenic
1176041921 20:63070226-63070248 CAGGGGAAGAACAGAGAGGCTGG - Intergenic
1178849175 21:36198828-36198850 CAGAGGTGTGACCGAGAAGCTGG + Intronic
1179109316 21:38432715-38432737 CAGATGAAGCACAGAGAGGTTGG + Intronic
1179325156 21:40335013-40335035 TTGAGGAATAACAGAGAGGCTGG - Intronic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1182662233 22:31933279-31933301 GAGAGGTATCAGAGAGAGGATGG - Intergenic
1183387447 22:37523182-37523204 CAGAGGATTGACAGAGAGGATGG + Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184583121 22:45430340-45430362 CAGAGTTTTCACAGTGAGGAGGG + Intronic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
950142289 3:10623683-10623705 CAGTGGTATCACAGAGAACCAGG - Intronic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
952377355 3:32778924-32778946 CAGAGGTAGCACTGAGATGAAGG - Intergenic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
953957171 3:47240478-47240500 CAGAGGTATCACTGGGAGATGGG - Intronic
954658772 3:52215156-52215178 CAGGGGCAGCACAGAGGGGCAGG - Intergenic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
955810053 3:62778503-62778525 AAGAGGTATCATTCAGAGGCTGG - Intronic
955978315 3:64498914-64498936 CAGAGGGATCAGAGAGTGACAGG - Intergenic
958616059 3:96494445-96494467 CAGAGGGAGGACACAGAGGCAGG - Intergenic
958772150 3:98437824-98437846 GAGAGGCCTCACAGAGAGCCAGG + Intergenic
958834176 3:99124537-99124559 CTGAGGTCTCACAAAGAGGAAGG + Intergenic
959551279 3:107661669-107661691 CAGAGAAATCACAGACAGGGAGG - Intronic
961202148 3:125053844-125053866 TACAGGTATTACAGAGAGGTAGG - Intronic
962181306 3:133208784-133208806 CAGAGGTAAGACAGTGAGGCAGG - Intronic
962828313 3:139118935-139118957 GGGAGGCAGCACAGAGAGGCAGG + Intronic
964443175 3:156732946-156732968 CAGACACATCACAGAGATGCTGG + Intergenic
964550209 3:157877261-157877283 CAGAGGTATCAGAGAAAAGCAGG + Intergenic
964801643 3:160565067-160565089 CAGAGGCGTCACAGACGGGCCGG + Intronic
965376782 3:167934609-167934631 CTGAGGTTTCTCAGAGAGGAAGG - Intergenic
965883182 3:173411792-173411814 CAGATGTAACCCAGAGAAGCAGG - Intronic
969331936 4:6478885-6478907 CAGAGGTAACAGAGAGAGACAGG + Intronic
970229851 4:13898448-13898470 TAGAGGTATCAGAGGGAGTCTGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971362661 4:25951854-25951876 CACAGGGCTCACAGAGGGGCTGG + Intergenic
971538880 4:27790247-27790269 CAGAGGAATCTCAGACAGACTGG - Intergenic
973582778 4:52360667-52360689 CAAAGGTAGATCAGAGAGGCAGG - Intergenic
976839482 4:89414511-89414533 CAGACTTATCTCAGAGAGGGTGG - Intergenic
976990676 4:91361067-91361089 CAAAGTTATCACAGAGGGGGAGG + Intronic
979089641 4:116465723-116465745 CAGAGGCATCACCAAGGGGCAGG + Intergenic
979340153 4:119513154-119513176 GAGAGGTATTAAAGATAGGCTGG - Intronic
979485777 4:121268550-121268572 CAGAGGTGTGAGAGAGAGGAAGG + Intergenic
979994979 4:127420842-127420864 CAGAGATCTCAAAGAGAGCCAGG + Intergenic
980117393 4:128692480-128692502 CAAAGGGATTTCAGAGAGGCCGG + Intergenic
981569273 4:146134399-146134421 CTGAGGCATCACAGACAAGCAGG + Intergenic
983439004 4:167756850-167756872 CAGATGTATCCCAGAGATTCTGG - Intergenic
985915489 5:2915405-2915427 CAGGCGTATCACAGAGAGTGAGG + Intergenic
986501230 5:8401995-8402017 CAGAGGTATAACAGTGAGTCTGG - Intergenic
987238878 5:15972225-15972247 CAAAGCTGTCACAGAGAGGAAGG - Intergenic
988702050 5:33685326-33685348 AGGAGGAATGACAGAGAGGCAGG - Intronic
992567883 5:78019481-78019503 CAGATGTAAAGCAGAGAGGCAGG + Intronic
993559140 5:89382036-89382058 CAGAGCTATAACAGAGTTGCTGG + Intergenic
994019263 5:95004545-95004567 CTGAGGTGGCACAGAGAAGCAGG - Intronic
1000635130 5:163635295-163635317 CAGGGGTTTCTCAGAAAGGCAGG - Intergenic
1001259832 5:170218948-170218970 GAGAGGTGTGAGAGAGAGGCTGG + Intergenic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1002303776 5:178271970-178271992 CAGCGGAAGCCCAGAGAGGCAGG - Intronic
1002610305 5:180413433-180413455 CCTAGGTATAACAGAGAGTCGGG + Intergenic
1003137450 6:3444677-3444699 CACAGGGCTCAGAGAGAGGCCGG - Intronic
1005433921 6:25787707-25787729 CAGTAGTTTCACAGATAGGCAGG - Intronic
1005991902 6:30908432-30908454 CAGAGGTATGAGAGAGAGAGAGG + Intronic
1007386271 6:41522315-41522337 TAGAGGTAGAACAGAGAGGTGGG + Intergenic
1008664975 6:53707142-53707164 CAGATGTATCCTAGAGAGACAGG + Intergenic
1008677339 6:53834030-53834052 GGGAGGTATCACAGAGCAGCAGG - Intronic
1011534928 6:88366441-88366463 GAGAGATTTCACAGGGAGGCAGG + Intergenic
1012454481 6:99389419-99389441 CAAAAATAGCACAGAGAGGCTGG - Intronic
1013270616 6:108542470-108542492 CGGACTTATCACAGTGAGGCAGG - Intergenic
1016290861 6:142526908-142526930 CAGAGGTACCAAAAAGAGACAGG - Intergenic
1016291687 6:142534730-142534752 CAGAGGTTGCACAGAGCAGCAGG - Intergenic
1016891326 6:149010301-149010323 CAATGGTCTCACAGAGAGTCTGG - Intronic
1019724726 7:2595263-2595285 CGGAGCTGTCACTGAGAGGCAGG + Intronic
1019759573 7:2800520-2800542 CAAAGATAGTACAGAGAGGCAGG - Intronic
1020962374 7:14821465-14821487 GAGAGGTCTCATAGAGGGGCTGG + Intronic
1022036014 7:26535328-26535350 CTGAGGAAACACATAGAGGCAGG + Exonic
1022713059 7:32870518-32870540 CAGAAGTAACACAGAGAGCTTGG - Exonic
1023857546 7:44193909-44193931 CAGAGCTGTCAAAGAGGGGCAGG - Intronic
1024399886 7:48912313-48912335 CAGAGCCATGACACAGAGGCTGG - Intergenic
1028859342 7:95630761-95630783 CAGTGGTTTCTCAGAGATGCAGG + Intergenic
1029463524 7:100710704-100710726 CAGAGAGATCACAGTGGGGCGGG + Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1030098532 7:105923374-105923396 CAGAGGTATAATTGTGAGGCTGG + Intronic
1030928902 7:115497456-115497478 TAAAAGTATCACAGAAAGGCTGG - Intergenic
1031650325 7:124281112-124281134 CAGACGTATCACAGAGAAAATGG - Intergenic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1032465310 7:132140709-132140731 CTGAGCCACCACAGAGAGGCAGG + Exonic
1033208526 7:139442839-139442861 AAAAGCTATCACAGAGAGCCAGG + Intergenic
1033330643 7:140414336-140414358 CAGAGATAGCACAGAGGGGCCGG - Intronic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036294653 8:7526255-7526277 CAGAGAGATCACAGTGAGGGAGG - Intergenic
1036327909 8:7794736-7794758 CAGAGAGATCACAGTGAGGGAGG + Intergenic
1036948945 8:13122455-13122477 CAAAGGAATTACAGAGAGGTTGG + Intronic
1037036279 8:14172059-14172081 AAGAAGTATCACAGAAAGTCTGG + Intronic
1037433667 8:18840733-18840755 CAGACCTCTCCCAGAGAGGCAGG - Intronic
1039463186 8:37762845-37762867 GAGGGGTCTCCCAGAGAGGCGGG + Intronic
1039731126 8:40280026-40280048 CTGTGATATCACAGAGATGCTGG - Intergenic
1043127744 8:76421211-76421233 CAGAGGTACCACAGCATGGCAGG + Intergenic
1044556290 8:93565822-93565844 CAGAGGTGGCACAATGAGGCTGG - Intergenic
1049505533 8:142994440-142994462 CAGAGAGGTCCCAGAGAGGCTGG - Intergenic
1050189572 9:3010534-3010556 AAAAAGTATCACAGAGAGGAAGG + Intergenic
1050424722 9:5501562-5501584 CAGAGGGAAGACACAGAGGCTGG + Intergenic
1051097059 9:13477876-13477898 CAGAGGGATGACACAGATGCTGG - Intergenic
1051356526 9:16244129-16244151 CAGAGGTAGCACAGAGCCCCAGG - Intronic
1051811457 9:21054312-21054334 CAGAACTATCACAGAAAGGCAGG + Intergenic
1053010184 9:34628476-34628498 CAGAGGTATCAGGCAGAGACAGG + Intergenic
1053018468 9:34677809-34677831 AAGAGGTAGGACACAGAGGCTGG - Intergenic
1053098184 9:35347408-35347430 CAGTAGTAGCAAAGAGAGGCTGG + Intronic
1053526120 9:38832705-38832727 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054198347 9:62057130-62057152 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054640007 9:67531233-67531255 CAGAGGAAGCCCAGAGAGGCTGG - Intergenic
1055040626 9:71867788-71867810 CAGAGGTATCATAGAGACAATGG + Intronic
1056646270 9:88414468-88414490 CTGTGGTATAACAGAGAGACTGG - Intronic
1060426481 9:123510882-123510904 CAGAGGTATGCAAGAGAAGCTGG + Intronic
1061903308 9:133683991-133684013 CAGATGGAGCTCAGAGAGGCTGG - Intronic
1062727295 9:138082848-138082870 CAGAGGTGTAACAGAGACACTGG + Intronic
1188573601 X:31618984-31619006 CAGAGGAAAAACTGAGAGGCTGG - Intronic
1189140309 X:38598269-38598291 TAGAGATTTCACAGAGAGGAGGG - Intronic
1189900305 X:45699614-45699636 AAGAGATATCAGAGAAAGGCTGG + Intergenic
1190033115 X:46993515-46993537 CAGAGGTATAACGGAGAAGGGGG - Intronic
1192982996 X:76367043-76367065 CAGCAGTATCACAGATGGGCAGG + Intergenic
1194416165 X:93615050-93615072 CAGAGGAATAACAGGGAGTCTGG + Intergenic
1195395992 X:104411163-104411185 CTGAGGTGTGACAGAGTGGCAGG - Intergenic
1199029896 X:142985269-142985291 CAGACGTAGCATAGAGAGGTTGG + Intergenic
1199241770 X:145555124-145555146 CTGAAGTATTCCAGAGAGGCTGG - Intergenic
1199405247 X:147450107-147450129 CAGAGGTCACACAGAGATGCTGG - Intergenic
1199856344 X:151762007-151762029 CAGATGTCTCACAGACAGGCTGG + Intergenic
1199908864 X:152262836-152262858 AACTGGTATCACAGAGAGTCGGG - Intronic
1200154333 X:153967352-153967374 CTGATGAAACACAGAGAGGCCGG - Intronic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic