ID: 1141718961

View in Genome Browser
Species Human (GRCh38)
Location 16:85744540-85744562
Sequence CACCGCATCTGGCTGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141718961_1141718972 19 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718972 16:85744582-85744604 GCACTTTGGGAGGCCAAGGCGGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1141718961_1141718971 18 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718971 16:85744581-85744603 AGCACTTTGGGAGGCCAAGGCGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1141718961_1141718967 9 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718967 16:85744572-85744594 TGAAATCCCAGCACTTTGGGAGG 0: 1326
1: 296799
2: 267546
3: 155755
4: 134271
1141718961_1141718965 6 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718965 16:85744569-85744591 GCCTGAAATCCCAGCACTTTGGG 0: 966
1: 222071
2: 273245
3: 185013
4: 143550
1141718961_1141718973 22 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718973 16:85744585-85744607 CTTTGGGAGGCCAAGGCGGGCGG 0: 17665
1: 104567
2: 162703
3: 161462
4: 107266
1141718961_1141718969 15 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718969 16:85744578-85744600 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1141718961_1141718964 5 Left 1141718961 16:85744540-85744562 CCTGTCAGCAGCCAGATGCGGTG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1141718964 16:85744568-85744590 TGCCTGAAATCCCAGCACTTTGG 0: 496
1: 93050
2: 232155
3: 241715
4: 215236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141718961 Original CRISPR CACCGCATCTGGCTGCTGAC AGG (reversed) Intronic
900126425 1:1070817-1070839 CAGCCCCTCTGGCTGCAGACAGG - Intergenic
900744826 1:4353922-4353944 CATCGAGTCTGGCTGCTGAATGG + Intergenic
900920259 1:5665604-5665626 CACCTCAGCTGGCTGCTCAGAGG + Intergenic
901288398 1:8101460-8101482 CACCGCACCTGGCTGCAAACAGG + Intergenic
901828865 1:11880028-11880050 GACCGCTTCTGGCTCCTGCCAGG + Intergenic
901937206 1:12635161-12635183 GACCGCATCTCGCTGCAAACTGG + Intergenic
904804751 1:33122914-33122936 TACGGCATCTGGCTGCTGAGTGG - Intergenic
908006225 1:59732047-59732069 CACAGCAACTGGATGATGACGGG - Intronic
909486730 1:76182251-76182273 CACTGCATTTGGGTGCTGATTGG - Intronic
910742375 1:90534021-90534043 CCCAACTTCTGGCTGCTGACAGG - Intergenic
911165887 1:94724000-94724022 CACCGCATCTTGCACCTTACAGG + Intergenic
911399017 1:97351245-97351267 CACTGCATCTGGAAGCTGACAGG + Intronic
915307297 1:154987972-154987994 CACCACCTCAGGCTGCTGAGGGG - Intronic
915342039 1:155181948-155181970 CCCTGCTGCTGGCTGCTGACCGG + Exonic
916320407 1:163498696-163498718 CACCCCATCTGGGAGGTGACAGG - Intergenic
918240761 1:182618079-182618101 CACAGCAGCTGTCTGCTGCCAGG - Intergenic
920673078 1:208019414-208019436 CTGCTCATTTGGCTGCTGACAGG + Intergenic
920751569 1:208682896-208682918 CCAAGCATCTGGCTGCTGACAGG + Intergenic
923778056 1:236997537-236997559 CCTCGCGTCTGTCTGCTGACAGG + Intergenic
924223828 1:241904605-241904627 CACAGCATCTGGAGTCTGACGGG - Intergenic
1067232388 10:44421195-44421217 CACTGCAGAGGGCTGCTGACTGG + Intergenic
1067832988 10:49621046-49621068 CACAGGCTCTGGCTGCTGGCAGG - Intronic
1068688953 10:59896364-59896386 CTCCACATCTGGGTGCTTACTGG + Intronic
1070740545 10:78900398-78900420 CAGCACAGCTGGGTGCTGACTGG + Intergenic
1070761750 10:79028344-79028366 CACCTCATAGGGCTGCTGGCAGG - Intergenic
1071518898 10:86316784-86316806 CATCTCATCTGGCAGCTGAATGG - Intronic
1072514711 10:96168224-96168246 CACCTCACTTGGCTGCTCACTGG + Intronic
1076909913 10:133381935-133381957 CACCGCACTTTGCTGCAGACAGG + Intronic
1081305716 11:41509485-41509507 CATCGCACCTGGCTGCGGATGGG - Intergenic
1081809183 11:45905767-45905789 CAGGACAGCTGGCTGCTGACAGG + Exonic
1083029351 11:59577777-59577799 CACCGCACCTGGCTGCTGATGGG + Intronic
1084674922 11:70628726-70628748 CACCGCCTCTGGGTGGTGAGGGG + Intronic
1086390588 11:86359109-86359131 CACTCCATATGGCTGCTGACTGG - Intergenic
1087291067 11:96321097-96321119 CACAGCATATGGCTGCCCACTGG + Intronic
1089197254 11:116701532-116701554 CACCTATTCTGGCAGCTGACTGG + Intergenic
1089831804 11:121335616-121335638 CACAGCATCTGGCTGCGGGGTGG + Intergenic
1090893146 11:130945395-130945417 CAGAGCATCAGGCTGCAGACAGG + Intergenic
1093372920 12:18386200-18386222 CACGGCAGCGGGCTGCAGACTGG - Intronic
1095942609 12:47736810-47736832 CACCCTGGCTGGCTGCTGACAGG + Intronic
1099461539 12:82927729-82927751 CAACGCTGATGGCTGCTGACTGG - Intronic
1104117524 12:125764139-125764161 CGCCGCACCTGGCTGCAGCCAGG - Intergenic
1107426233 13:40295881-40295903 CACTGCATCTGGCCCCTGTCAGG + Intergenic
1108478124 13:50841574-50841596 CACCACATCTGGCTGATTTCAGG - Intronic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1114503429 14:23189472-23189494 CAGCACATCTGTATGCTGACAGG - Intronic
1119513540 14:75230210-75230232 CACCTAATCTGGCTGCTGATTGG - Intergenic
1120930344 14:89841917-89841939 CAACGCATCGGAGTGCTGACCGG + Intronic
1124097310 15:26660598-26660620 CACAGAATCTGGCTGCTGTGTGG - Intronic
1124906320 15:33872067-33872089 TACGACATCTGGCTGCAGACAGG + Intronic
1125177469 15:36841331-36841353 CACTGCTTCCGGCTGCTAACAGG + Intergenic
1125843485 15:42828425-42828447 CACCGCACCTGGCTGCTTATAGG - Intronic
1128245180 15:66127987-66128009 CACCCCATCTGGCTGTGGACAGG + Intronic
1129356963 15:74997702-74997724 CACCACCTTTGGCTGCTCACAGG - Intronic
1129898297 15:79124799-79124821 CACTGCATTTGACTGGTGACTGG - Intergenic
1129938662 15:79473945-79473967 CACTGCATCTGGCTAATGAATGG + Intergenic
1130401272 15:83556846-83556868 CAGCTCACCTGGCAGCTGACCGG - Intronic
1132074367 15:98807551-98807573 AATCCCATCTGGCTGCTGAGTGG - Intronic
1132687183 16:1167247-1167269 CACCGGGACGGGCTGCTGACAGG - Intronic
1133218047 16:4305376-4305398 CACCGCACCCGGCTGCTAAAGGG + Intergenic
1134009868 16:10843890-10843912 CACCACAGCTGCCTGCTGATTGG - Intergenic
1135358817 16:21793577-21793599 CAGAGCATCTGGCTGGTGACGGG - Intergenic
1135457373 16:22610013-22610035 CAGAGCATCTGGCTGGTGACGGG - Intergenic
1136403106 16:30029084-30029106 CACCCCATCTGGGTGCTGGCTGG + Intronic
1137500808 16:49010598-49010620 CTCTGGATCTGGCTGCTGAGAGG - Intergenic
1140034452 16:71361621-71361643 CACCCCTTCTGGATGCTGGCTGG + Intronic
1140049711 16:71469561-71469583 AAGCACACCTGGCTGCTGACTGG + Intronic
1140411122 16:74740971-74740993 CCCCACGTGTGGCTGCTGACTGG - Intronic
1140533858 16:75691263-75691285 CACCACACCTGGCTGAAGACAGG - Intronic
1140567076 16:76056004-76056026 CACACCATGTGGCTGCTGCCAGG + Intergenic
1141718961 16:85744540-85744562 CACCGCATCTGGCTGCTGACAGG - Intronic
1142182210 16:88676819-88676841 CCCTGCTTCTGGCTGCAGACAGG - Intergenic
1143304753 17:5937513-5937535 CACCGCACCTGGCTTGTGAATGG + Intronic
1143587397 17:7857136-7857158 CAGCGCCTCTAGCTGCTGTCGGG + Exonic
1143691570 17:8571492-8571514 CACCGCGCCTGGCCCCTGACTGG - Intronic
1144179546 17:12739252-12739274 CCCCGCATCTGACTGGTGGCTGG - Exonic
1144468711 17:15517876-15517898 CACCGCATCTGGCTGAGGCTGGG - Intronic
1145201027 17:20944801-20944823 CACCACGTGTGGCTGCTGCCGGG + Intergenic
1145980390 17:29007686-29007708 CACGCCATCTGCCTGCTGCCTGG - Intronic
1148180363 17:45600801-45600823 CAGGACAGCTGGCTGCTGACAGG - Intergenic
1148268537 17:46245093-46245115 CAGGACAGCTGGCTGCTGACAGG + Intergenic
1149551599 17:57544497-57544519 CAGCGAATCTTGCTGCTGCCAGG + Intronic
1150833523 17:68543703-68543725 CTCCTCATCTCGCTGCTGTCTGG + Exonic
1152700802 17:81817997-81818019 CAAAGCATCTGGCTGCTGTGTGG - Intergenic
1153245107 18:3065755-3065777 CACAGCATCTGGCTCCTGCCTGG + Intergenic
1154236572 18:12611455-12611477 CACTTCATCTGGCTGTTGGCAGG - Intronic
1156226950 18:35118811-35118833 CACCTGACCTGGCTGCTGAGTGG + Intronic
1156233506 18:35178965-35178987 CACTGCTGGTGGCTGCTGACAGG - Intergenic
1157199471 18:45646753-45646775 CACCTCATCTACCTGCTGAATGG + Intronic
1161250544 19:3277648-3277670 CACTGCACCTGGCTCCAGACTGG - Intronic
1161553847 19:4929344-4929366 CACCGACTCCGGCTGCTGCCTGG + Exonic
1162603434 19:11688323-11688345 CACCGCACCTGGCTGATACCAGG + Intergenic
1163478793 19:17542436-17542458 CACCACATGTGGCTGCTGCCTGG - Intronic
1165390690 19:35537037-35537059 CCCCTCCTCTGGCTGCTAACTGG + Intronic
1167835267 19:52063161-52063183 CACCGCATCTGGCTGAGAAATGG + Intronic
1167897481 19:52593496-52593518 CACCCCATCTGGCAGGTGAGGGG - Intergenic
1168324944 19:55533740-55533762 CACTGCATCTGGCTGCAGAGTGG - Intronic
925804305 2:7633105-7633127 CACAGCATCTAGCTGATGTCTGG - Intergenic
927225846 2:20765784-20765806 CACAGCAGCTGGCTTCTGAGAGG + Intronic
930971996 2:57407786-57407808 CACAGCATGTGGCTGCTGCCAGG - Intergenic
931190849 2:59998827-59998849 CAACACATATGGCTTCTGACTGG + Intergenic
931386913 2:61805927-61805949 CACCACATCTGGCTGAGAACAGG - Intergenic
932242539 2:70168574-70168596 CACCGCACCCGGCTGCTAATAGG + Intronic
938789011 2:134660156-134660178 CATGGCATCTGGGTGCTGAATGG - Intronic
939663838 2:144924964-144924986 CACTGCAGCTGACTGCTCACAGG - Intergenic
940263328 2:151808757-151808779 CACCACACCTGGCTGATGAATGG - Intronic
940788583 2:158007772-158007794 CACCACATCTGGCTAGAGACAGG + Intronic
942377678 2:175354003-175354025 CACTGCATCTGGCTGCTCAAAGG - Intergenic
946515132 2:220403254-220403276 CACCATATCTGGCTGGTGCCAGG - Intergenic
949050731 2:241896086-241896108 GACCGCCTCGGGCTGCTGAAGGG + Intronic
1172167209 20:32906714-32906736 CACAGCATCTGGCCTCTGTCTGG + Intronic
1172781037 20:37437226-37437248 CACCTCATCTACCTGCTGAGAGG - Intergenic
1174341046 20:49895623-49895645 CACCGCATCTGGCCGATTATAGG + Intergenic
1174410961 20:50335238-50335260 CACCTCTTCTGGCAGCTGGCTGG - Intergenic
1175442609 20:59002117-59002139 GACCGCATCTGGCCCCTCACTGG - Intronic
1175830269 20:61961107-61961129 CACCGCGCCTGGCTGATGTCGGG + Intronic
1180818150 22:18806017-18806039 CCCCGCATCTCTCTGCTGCCTGG - Intergenic
1181204370 22:21240472-21240494 CCCCGCATCTCTCTGCTGCCTGG - Intergenic
1182586205 22:31345657-31345679 CCCCGCTTCTCGCTGCTGAGGGG - Exonic
1183693100 22:39402302-39402324 CACCGCATCTGGCTAAGGACAGG + Intronic
1184064394 22:42109006-42109028 CCCCGCCTCTGGCTGCCGGCAGG - Intergenic
1185368135 22:50446306-50446328 GACCACATCTGGCTCCTGCCAGG - Exonic
1203222552 22_KI270731v1_random:54943-54965 CCCCGCATCTCTCTGCTGCCTGG + Intergenic
1203268277 22_KI270734v1_random:31871-31893 CCCCGCATCTCTCTGCTGCCTGG - Intergenic
950080621 3:10219604-10219626 CACCGCACCTGGCTGCCATCAGG + Intronic
955650263 3:61186522-61186544 CACCTCTTCTGTCTGCAGACTGG - Intronic
956386723 3:68727340-68727362 CCCCTCATATGGCTGCTGAATGG + Intergenic
957157957 3:76569834-76569856 CACTGCACCTGGCTGCTTATTGG - Intronic
958064002 3:88519500-88519522 CACCGCAGCTGGCTGCAAAGGGG + Intergenic
960439670 3:117671309-117671331 CAACCCATCCAGCTGCTGACTGG + Intergenic
963203810 3:142612596-142612618 CACCACAACTGGCTGGTGAAGGG - Intronic
967658591 3:192077946-192077968 CACAGCATGTGGCAGCTGAAGGG - Intergenic
972675603 4:41257188-41257210 CACCGGTTCCGGCTGCTGGCAGG + Intronic
973846486 4:54918037-54918059 CACAGCATCTGGCCACTGCCAGG - Intergenic
977303026 4:95289739-95289761 CACCAAATCTGGCTGTTAACAGG + Intronic
977379440 4:96252930-96252952 CCCCTCATTTGGATGCTGACTGG - Intergenic
980934864 4:139216929-139216951 CACCGCACCTGGCTGATGCCTGG - Intergenic
988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG + Intergenic
988968438 5:36442643-36442665 CACCCTAACTGCCTGCTGACTGG + Intergenic
994976837 5:106818923-106818945 CACCGCACCTGGCTGATGGGAGG - Intergenic
998379797 5:141716028-141716050 CACCATCTCTGGCTGCAGACAGG + Intergenic
1003403319 6:5808790-5808812 CAGCCCAGCTGGCTGGTGACGGG - Intergenic
1006639745 6:35483785-35483807 CACCACATCAGGCTGCCCACAGG + Intronic
1009856666 6:69273885-69273907 CACCTCAGGTGGCTGCTGACTGG - Intronic
1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG + Intergenic
1015983625 6:138863898-138863920 CACCGCATCTGGCCGGGAACAGG + Intronic
1017872900 6:158502086-158502108 CACCGCAGCTGGCAGCTGAGGGG + Exonic
1018181096 6:161224353-161224375 CACCACATCTGGCTGCAGTCTGG - Intronic
1019644528 7:2121884-2121906 CCCCACATCTGGCTGCTGCACGG - Intronic
1020015093 7:4826442-4826464 CATCACAACTGGCTTCTGACTGG - Intronic
1020755797 7:12201753-12201775 CACCGCACCTGGCTGAGAACTGG - Intergenic
1023858422 7:44201013-44201035 CTCAGCAGCCGGCTGCTGACGGG - Intronic
1026836655 7:73644184-73644206 CACTGCACCTGGCTGAGGACTGG + Intergenic
1027588836 7:80092174-80092196 CACTGCACCTGGCAGATGACTGG - Intergenic
1031966814 7:128032652-128032674 CACCCCCGCTGACTGCTGACGGG + Intronic
1033429442 7:141275548-141275570 CACCCCCTCTGGATGCTGAAGGG - Intronic
1035980165 8:4361660-4361682 CGTCGCACCTGGCTGCTGATAGG - Intronic
1036813041 8:11880613-11880635 CACCGCACCTGGCCCCTGGCTGG - Intergenic
1041200589 8:55449894-55449916 GACCGCATCTGGCTCCCGCCAGG - Intronic
1043099548 8:76023773-76023795 CATCGCATATGGCTGCAGGCAGG - Intergenic
1045296747 8:100878055-100878077 CACCTCATGGAGCTGCTGACCGG - Intergenic
1045374145 8:101554135-101554157 CACAGCATATGGCTGCTGGTTGG - Intronic
1052818329 9:33119148-33119170 CACTGCACCTGGCCACTGACAGG + Intronic
1056207966 9:84338643-84338665 CACAGCAACTGGCTGCTCCCAGG - Intronic
1058429975 9:104909568-104909590 CACTGAATCTGTCTGCTGTCTGG - Intronic
1059227227 9:112683176-112683198 CACCGCACCTGGCTGGCCACAGG - Intergenic
1060596178 9:124850503-124850525 CACTGCATCTGGCTGGGAACAGG + Intergenic
1061309197 9:129751388-129751410 CACCGCACCTGGCTGAGGCCTGG - Intronic
1061961102 9:133989761-133989783 TACTGCATCTGGCTGCACACAGG - Intronic
1062575149 9:137203073-137203095 CACCGCATCTGGCCCCAGACAGG + Intronic
1200127099 X:153820792-153820814 CCCTGCATCTGGCGGCTGGCAGG + Intronic